TABLE 1.

Primers used in this study

PrimerGene, primer typeSequence (5′ to 3′)
Pre-PenA-1blaPEN-A, externalGCGTTCCGCATTCGTTTCGC
Pre-PenA-2blaPEN-A, externalTGGCCGCTCACGCGAGCGTC
PenA-1blaPEN-A, internalTTACACCATTCTCGGCACGG
PenA-2blaPEN-A, internalAGAAACAAGGAACTGTTGGC
Pre-PenB-1blaPEN-B, externalCTCATCGAAACGTCGAACCC
Pre-PenB-2blaPEN-B, externalCGTCTGCGTGTAGTACACGG
PenB-1blaPEN-B, internalGTCTCGATAGTGCTGTCTCG
PenB-2blaPEN-B, internalTTACGTGCCAGTTGCTGACG