TABLE 1.

PCR primers used in this study

Primer designationPrimer sequence (5′→3′)Annealing temp (°C)Amplicon size (in bp)Reference
blaZ_fwTGCTTCAACTTCAAAAGCGATA55563This study
blaZ_rvGTTCAGATTGGCCCTTAGGA
dfrK_fwGCTGCGATGGATAAGAACAG50214 3
dfrK_rvGGACGATTTCACAACCATTAAAGC
dfrK_inv1CGGAAGAGCATTACCTGGAA553,642This study
dfrK_inv2AATTGGATATCCCTTTGTAGTATTTTT
Tn559_circ-fwTCCATGAACTCGTACAGCAA55778This study
Tn559_circ-rvTGGTTGTGAAATTGTCCATTC
radC_fwGGAAAGGATGGGGAGAAGAG552,305This study
tnpB_rvTGCTTCAATTTCCACTCTCG