TABLE 3

Primer sequences used for quantitative real-time PCR

Gene IDaCommon namePrimer sequence (5′ to 3′)
Forward primerReverse primer
PF3D7_API02900Elongation factor TuGATATTGATTCAGCTCCAGAAGAAAATATCCATTTGTGTGGCTCCTATAA
mal_mito_3Cytochrome bAGATACATGCACGCAACAGGTCATTTGACCCCATGGTAAGA
PF3D7_1252200ChitinaseTGTTTCCTTCAACCCCTTTTTAATCCAAACCCGTCTGCTC
PF3D7_0717700Serine-tRNA ligase (putative)AAGTAGCAGG TCATCGTGGTTGTTCGGCACATTCTTCCATAA
PF3D7_1462800Glyceraldehyde-3-phosphate dehydrogenaseATCAAAGGGTGGTAAGGACTGGAGTGGACCTTCAGCAGCTTTTT
  • a ID, identifier.