TABLE 1.

Primer sequences used in qPCRa

PrimerSequence (5′→3′)Fragment size (bp)
ACT1 f1ATCAAGGTATCATGGTTGGTATGG100
ACT1 r2TGTTCAATTGGGTATCTCAAGGTC100
RPP2B f3ACTTAGCTGCTTACTTATTGTTAG143
RPP2B r4GTCTTTACCTTCCAAATCTTTCA143
MCAI f3AGGGTATAACCAAGGTTACG200
MCAI r4CAGAAGGTCTATTGTATTGTCC200
  • a All primers were optimized at 58°C and showed efficiencies between 90 and 110%.