TABLE 2.

PCR primers

Primer namesPrimer sequences (5′ to 3′)Purpose
pACICU2A, pACICU2BTTTAAAACCCATTTACATCTCCTT, AAAACCGCTCGAAAAGATCADetermine presence of ISAba125 at 34.9-36.0 kbp
aphA, aphBTTTGACGTTGCTCTTGTTGC, TGCACAATGTGATGGAGTCTTest insertion at 10.7 kb of pACICU2
aphC, aphDTCAAGCTCTAGCCGAAAACAA, TTCATCTATTTCAAATTCATCTTGCTest insertion at 21.9-22.3 kb of pACICU2
aphE, aphFCATTTTCTTTCGCATACAGCA, TTTTTGCAATTTCAGCTTGAGTest assembly across aphA6 region
aphK, aphJCAGGGGTATATGATGCACTTGA, ATCACATATCCCGCTTCTGGTest assembly across aphA6 region
aphG, aphLGAGGCCCGCATTTAATCTCT, ATGGGTGGCAAAGTAAGGTTTest insertion at 21.9-22.3 kbp of pACICU2
RIB, RI3AGGTGACGATTTCCGATGAC, CTCAAGTAGATTGCGAATCGTGTest RI structure in AB056, AB058
RIE, RI6TTGCTCGGCCTTCAGCCTGC, GCCTTGCTCCGCAGCGGTTATest RI structure in AB056, AB058