TABLE 2.

Primers used for amplification and sequencing of HSV-2 UL23 and UL30 genes

Target geneFunctionNameSequence (5′→3′)a
UL23First-round PCR (outer primers)TK2-F1F: GTACCCACGGCCCAAAGAG
TK1-R1R: CGAATTCGAACACGCAGAT
Second-round PCR (inner primers)TK2-F2F: CTATCGGAGGCCCTTTGTTG
TK2-R2R: CGAGGTCCACTTCGCATATT
Sequence reactionTK2-AR: ATCGAGGACACGCTGTTTG
TK2-BF: AAGACCCAGGCAAAAATGTG
TK2-CR: AGCGCCCAGATAACAATGAG
TK2-DF: CCGATATGAGGAGCCAAAAC
+ TK2-F2 and TK2-R2
UL30First-round PCR (outer primers)POL2-F1F: GACACCACACACTGGCTCTC
POL2-R1R: AGACGCAACGCAGAGAAAC
Second-round PCR (inner primers)POL2-F2F: ATCCCACCCCGAGCTGTT
POL2-R2R: GTCGGCCGCAGACATTTAT
Sequence reactionPOL2-AR: TACACGTGGAAGACGGTGAC
POL2-BF: CGCCCCTAAGGTGTACTGC
POL2-CR: CCCCTCGTACTTCCTGATCG
POL2-DF: ACTTCGAGGCGGAGGTG
POL2-ER: ATCCGAGCGAAAACAGGAG
POL2-FF: GGAAGACCTCGTCATCCAGA
POL2-GR: GATGTCGCGGTAGCTCAGAT
POL2-HF: CCGACAAGGTCAAACTCTCC
POL2-IR: AGGCTGGCAAAGTCAAACAC
POL2-JF: GATAAGGACGACGACGAGGA
POL2-KR: CCAGCAGCTGATCGAACTC
POL2-LF: GGTGCAGCACGGTCTTCT
POL2-MR: GATGGGCGTCTACGAGGA
POL2-NF: CTGGTGCGCAAAAACAACT
POL2-OR: CCAGCAGGTGCGAGAAGTA
+ POL2-F2 and POL2-R2
  • a F, forward; R, reverse.