TABLE 2.

Primer and probe details

Primer/probeaSequence (5′-3′)Amplicon and/or purposeb
Tndx (F30)CTTACAATGTTAAAACAGCAAGC1.6-kb fragment of tndX
Tndx (R1612)GAGAATGTATCAATGAGACACTG1.6-kb fragment of tndX 300-bp probe for Southern analysis
TndX probeCTTTAGGGAAAATAACTGAT300-bp probe for Southern analysis
LEOCCACTTGATATGAAAAATCAAATGGCTCsspPCR, CI, left-end transposon-genome junction
REOACGTGTATCAAGCAGAGGGAATCGGTAAAsspPCR, CI, right-end transposon-genome junction
PTS forward primerGTGTCAATGACCGCAGAAGAChromosomal target site, left-end transposon-genome junction
PTS reverse primerTCGCTAGAATGACCTGTAGAAGAAChromosomal target site, right-end transposon-genome junction
M13 forward primerGTAAAACGACGGCCAGTsspPCR
M13 reverse primerCAGGAAACAGCTATGACsspPCR
  • a PTS, phosphotransferase system.

  • b CI, circular intermediate.