TABLE 1.

Strains, plasmids, and PCR primers used

Strain, primer, or plasmidRelevant feature(s)fSource or reference
Strains
    DH10BCloning host strainInvitrogen
    L. monocytogenes EGDeSerotype 1/2a strain; genome sequenced15a
Primers
    Lmo1967_PstI_SOEACTCTGCAGTGGAGCTAACTGaThis study
    Lmo1967_SOEBCACTTGGCTTGTTCTCGGTCThis study
    Lmo1967_SOECGACCGAGAACAAGCCAAGTGACAAAACCCCACTCTTACGbThis study
    Lmo1967_XbaI_SOEDCCTCTAGAATGCTTGCGACcThis study
    Lmo1967_OutForCCAAGAGCGTAACAAAACGCThis study
    Lmo1967_OutRevGGAATGATTCATGCCTGTGThis study
    Lmo1967_comp_NCO_FCAAACCATGGCCGAGAACAAGCCdThis study
    Lmo1967_comp_PST_RGGGCTGCAGTTATTTCATTTCeThis study
    Marq207GGCCACGCGTCGACTAGTACNNNNNNNNNNGTAAT6
    Marq208GGCCACGCGTCGACTAGTAC6
    marq255CAGTACAATCTGCTCTGATGCCGCATAGTT6
    marq256TAGTTAAGCCAGCCCCGACACCCGCCAACA6
    marq257CTTACAGACAAGCTGTGACCGTCT6
    PL95ACATAATCAGTCCAAAGTAGATGC21a
    PL102TATCAGACCTAACCCAAACCTTCC21a
Plasmids
    pKSV7Temperature-sensitive integration vector; Cmr38a
    pIMK2Integrative vector, overexpression, 6.2 kb; Kanr26
    pMC38mariner delivery vector6
  • a The sequence in boldface type is the PstI restriction enzyme site.

  • b The underlined sequence is an overlap designed to complement primer Lmo1967_SOEB.

  • c The sequence in boldface type is the XbaI restriction enzyme site.

  • d The sequence in boldface type is the NcoI restriction enzyme site.

  • e The sequence in boldface type is the PstI restriction enzyme site.

  • f Primers are 5′ to 3′.