TABLE 1.

Primers used for amplification and sequencing of HSV-1 UL23 and UL30 genes

Target geneFunctionNameSequence (5′→3′)a
UL23First-round PCR (outer primers)TK1-F1F: TAACCCCCACGAACCATAAA
TK1-R1R: CGAATTCGAACACGCAGAT
Second-round PCR (inner primers)TK1-F2F: GGTGGGGTATCGACAGAGTG
TK1-R2R: GATCTTGGTGGCGTGAAACT
Sequence reactionTK1-AR: TATGGGCTGCTTGCCAATAC
TK1-BF: GTTATACAGGTCGCCGTTGG
TK1-CR: CCTCGACCAGGGTGAGATA
TK1-DF: GGTCGAAGATGAGGGTGAGG
+ TK1-F2 and TK1-R2
UL30First-round PCR (outer primers)POL1-F1F: CGGCTACGTCACTCTCCTGT
POL1-R1R: CGGAGATTCCGACCGTGT
Second-round PCR (inner primers)POL1-F2F: GCCGACGCGAATAAACC
POL1-R2R: GGCCGCAGACATTTATTGTAA
Sequence reactionPOL1-AR: GCTTGAGGTGACCGTCGT
POL1-BF: CGTACTATAGCGAATGCGATGA
POL1-CR: GAAGTGGTCCGCGGAGAT
POL1-DF: GGTCGACAGGCACCTACAAT
POL1-ER: ACCGGAAAGGCCAGCTC
POL1-FF: AGGACGAGCTGGCCTTTC
POL1-GR: CACGGCGTTGAGCTTGTAG
POL1-HF: GTGTGGGACATAGGCCAGAG
POL1-IR: GTCCTCCCCCTCCTCCTC
POL1-JF: CCGACCAGAAGGGCTTTATT
POL1-KR: GCTGCTTGTCCAGGAGCAC
POL1-LF: CCATGCGAAAGCAGATCC
POL1-MR: TCTTACCCCCGTAGATGACG
POL1-NF: ATCAAACTCGAGTGCGAAAA
POL1-OR: GCGACCGTCTCCTCTACCTC
POL1-PF: CAGGTCCCGTCCATCAAG
+ POL1-F2 and POL1-R2
  • a F, forward; R, reverse.