TABLE 2.

Primer sequences used for pmrCAB sequencing and quantitative PCR

PrimerSequence
pmrBAC_LGCGAGGAGCACATTTCCTAA
pmrBAC_RTGTAGTCACTCACGATGCTGAA
pmrBAC_L2TTAAAGTTACATCTTGCTTTGCC
pmrBAC_L2cGGCAAAGCAAGATGTAACTTTAA
pmrBAC_R2TCGATGAAATTCTAGATACTCAAATG
pmrBAC_L3CCCAAATATCGATAAACAGATCTTC
pmrBAC_R3TTGAAGCAGATCCGTCAAAG
pmrBAC_L4TGCACCCAAATTTAAACCATC
pmrBAC_R4CCGACTTGTGATACGAATGC
pmrBAC_L5TCATTTGGCTTAATACATGGTCTG
pmrBAC_R5GGATGATTTCACCGCAAAATAG
pmrBAC_R5cCTATTTTGCGGTGAAATCATCC
pmrA_1GGTGTTGCTGCTCTTTGACG
pmrA_2GGTGGAATGGGTCAATAACG
16S_rRNA_1CAGCTCGTGTCGTGAGATGT
16S_rRNA_2CGTAAGGGCCATGATGACTT