TABLE 1.

Novel PCR primers used in the study

Gene or region amplifiedPrimerNucleotide sequence (5′ → 3′)Nucleotide coordinates
cfrcfrF1GACTTTCGGCACCGGTAAT3419-3437a
cfrR3CAGTAGTCCATTCATATTTG4681-4662a
fexAfexAF2GCGTGATTCCTAAGCTATT7146-7164a
fexAR1GAGAACCGAATCTTTAATCA8800-8781a
radCradC-fw01AGAGAAAATGCCAATGCAATCA1736892-173687b
radC-rv02TCACCGATTATAATATGATCCAATAAATCT1736773-1736744b
  • a Nucleotide coordinates based on the nucleotide sequence of plasmid pSCFS3 (GenBank accession number AM086211).

  • b Nucleotide coordinates based on the nucleotide sequence of MRSA strain COL (GenBank accession number CP000046.1).