TABLE 1.

Primers used to sequence S. aureus ribosomal genes

PrimerSequence (5′ to 3′)Reference(s)
rrn1FGCGGTGTTTTGAGAGATTATTTA53
rrn1RGCTTCATGATATACGCTTCCTTT53
rrn2FGCAGACGCACAGGACTTA53
rrn2RGATACCGTCTTACTGCTCTTCTC53
rrn3FAGGCCGGCAATATGTAAG53
rrn3RGTCGTCAAACGGCACTAATA53
rrn4FTGTGGACGGTGCATCTGTAG53
rrn4RATCACCCGCTCCATAGATAAT53
rrn5FGCCGATAGCTCTACCACTG53
rrn5RAGGTGCGATGGCAAAACA53
rrn6FGAAAGGCGTAACGATTTGGG45, 55
rrn6RCGTTGACATATTGTCATTCAG45, 55
VdomainFGCGGTCGCCTCCTAAAAG53
rplCFATGGGCTTAAACTTACCATCThis study
rplDFAAAAGGTTTAGTAGAAATCAGThis study
rplVFGTACATTCAAAGGACACGTTGThis study
rplVRAATCACGGATAATACCAACACGThis study