TABLE 1.

Oligonucleotide primers used in this study

GeneaSequence (5′-3′)Ta (°C)Reference or source
Aminoglycoside resistance
    aac(6′)-aph(2") (F)GAGCAATAAGGGCATACCAAAAATC5624
    aac(6′)-aph(2") (R)CCGTGCAATTGTCTTAAAAAACTGG
    aac(6′)-Ii (F)TGGCCGGAAGAATATGGAGA5625
    aac(6′)-Ii (R)GCATTTGGTAAGACACCTACG
    ant(4′)-Ia (F)GGAAGCAGAGTTCAGCCATG5625
    ant(4′)-Ia (R)TGCCTGCATATTCAACACGC
    ant(6)-Ia (F)CGGGAGAATGGGAGACTTTG5625
    ant(6)-Ia (R)CTGTGGCTCCACAATCTGAT
    ant(9)-Ia (F)GGTTCAGCAGTAAATGGTGGT6025
    ant(9)-Ia (R)TGCCACATTCGAGCTAGGGTT
    aph(2")-Ib (F)ATGGTTAACTTGGACGCTGAG60This study
    aph(2")-Ib (R)TTCCTGCTAAAATATAAACATCTCTGCT
    aph(2")-Ic (F)TGACTCAGTTCCCAGAT487
    aph(2")-Ic (R)AGCACTGTTCGCACCAAA
    aph(2")-Id (F)GGTGGTTTTTACAGGAATGCCATC6024
    aph(2")-Id (R)CCCTCTTCATACCAATCCATATAACC
    aph(3′)-IIIa (F)CTGATCGAAAAATACCGCT6025
    aph(3′)-IIIa (R)ACAATCCGATATGTCGATGGAG
Macrolide resistance
    erm(A)-43b (F)TCTAAAAAGCATGTAAAAGAA5038
    erm(A)-664 (R)CTTCGATAGTTTATTAATATTAGT
    erm(B)-42 (F)GAAAGGGTACTCAACCAAATA5038
    erm(B)-658 (R)AGTAACGGTACTTAAATTGTTTAC
    erm(C)-94 (F)GATAATATCTTTGAAATCGGCTCA60This study
    erm(C)-636 (R)CCTGCATGTTTTAAGGAATTGTTA
    msr(A)-994 (F)GCAAATGGTGTAGGTAAGACAACT5044
    msr(A)-1375 (R)ATCATGTGATGTAAACAAAAT
Tetracycline resistance
    tet(K)-473 (F)TAGGGGGAATAATAGCACATT55This study
    tet(K)-1060 (R)AATCCGCCCATAACAAATA
    tet(L)-403 (F)AGGAAAATAGGGGTAAAGCAT55This study
    tet(L)-917 (R)CACCAATGTAGCCGAAAAT
    tet(M)-595 (F)GAACTCGAACAAGAGGAAAGC5532
    tet(M)-1312 (R)ATGGAAGCCCAGAAAGGAT
    tet(O)-197 (F)AACTTAGGCATTCTGGCTCAC5532
    tet(O)-713 (R)TCCCACTGTTCCATATCGTCA
    tet(Q)-100 (F)GGCTGTGTGGATAATGG50This study
    tet(Q)-816 (R)AGTCTCAGACTTCCGTCA
    tet(U)-28 (F)GATTGGCATGCGATGGTTC60This study
    tet(U)-295 (R)TCTCTGTCACATCCAACCC
    tet(S)-796 (F)GATGGTCAACGGCTTGTC50This study
    tet(S)-1366 (R)TGCCACTACCCAAAGGAA
    tet(W)-117 (F)GACAACGAGAACGGACACTATG551
    tet(W)-1341 (R)AAGCGGGAGCGGCGTAACAGAC
  • a The ermB-aadE-sat4-aphA-3 gene cluster was amplified using primers LPP1 and LPP2, and the amplicon was restricted with EcoRV as described previously by Werner et al. (42). Primers designed for this study were based on gene sequences from GenBank. vanA, vanB, vanC, vanD were described previously by Clark et al. (9). Enterococcal ligase primers were described previously by Dutka-Malen et al. (15).

  • b Numbers refer to nucleotide position in the gene sequence.