TABLE 2.

Primers used in this experiment

Primer for PCRNucleotide sequence (5′→3′)Constructed on:Location of primerGene(s) or gene allele(s) detected (primer pair)Expected size of product (bp)
Start position(s) in referenceStop position(s) in referenceReference SCCmec or SCC sequence(s)a
M-PCR 1 (for amplification of ccr gene complex type with mecA)
    mA1TGCTATCCACCCTCAAACAGGmecA4581345833Type II.1mecA (mA1-mA2)286
    mA2AACGTTGTAACCACCCCAAGAmecA4609846078Type II.1
    α1AACCTATATCATCAATCAGTACGTccrA12484524868Type I.1ccrA1-ccrB (α1-βc)695
    α2TAAAGGCATCAATGCACAAACACTccrA22632526348Type II.1ccrA2-ccrB (α2-βc)937
    α3AGCTCAAAAGCAAGCAATAGAATccrA354865508Type III.1ccrA3-ccrB (α3-βc)1,791
    βcATTGCCTTGATAATAGCCITCTccrB1, ccrB2, ccrB325539, 27261, 727625518, 27240, 7255Type I.1, II.1, III.1
    α4.2GTATCAATGCACCAGAACTTccrA487458764Type VIccrA4-ccrB4 (α4.2-β4.2)1,287
    β4.2TTGCGACTCTCTTGGCGTTTccrB41003110012Type VI
    γRCCTTTATAGACTGGATTATTCAAAATATccrC60319, 1683860346, 16811SCCmercury, type VccrC (γR-γF)518
    γFCGTCTATTACAAGATGTTAAGGATAATccrC60836, 1632160810, 16347SCCmercury, type V
M-PCR 2 (for amplification of mec gene complex class
    mI6CATAACTTCCCATTCTGCAGATGmecI4286642888Type II.1mecA-mecI (mA7-mI6)1,963
    IS7ATGCTTAATGATAGCATCCGAATGIS12722862428647Type I.1mecA-IS1272 upstream of mecA (mA7-IS7)2,827
    IS2(iS-2)TGAGGTTATTCAGATATTTCGATGTIS43187728748Type VmecA-IS431 upstream of mecA (mA7-IS2 [iS-2])804
    mA7ATATACCAAACCCGACAACTACAmecA44830, 31450, 796944808, 31428, 7991Type I.1, II.1, V
M-PCR 3 (for amplification of ORFs in J1 region of type I and type IV SCCmec)
    1a3TTTAGGAGGTAATCTCCTTGATGE00752785300Type I.1E007 in type I.1 SCCmec (1a3-la4)154
    1a4TTTTGCGTTTGCATCTCTACCE00754315411Type I.1
    4alTTTGAATGCCCTCCATGAATAAAATCQ00247264750Type IV.1CQ02 in type IV.1 (IVa) SCCmec (4al-4a3)458
    4a3AGAAAAGATAGAAGTTCGAAAGACQ00251835161Type IV.1
    4b3AACCAACAGTGGTTACAGCTTM00124572477Type IV.2M001 in type IV.2 (IVb) SCCmec (4b3-4b4)726
    4b4CGGATTTTAGACTCATCACCATM00131823161Type IV.2
    4c4AGGAAATCGATGTCATTATAACR00882608240Type IV.3CR008 in type IV.3 (IVc) SCCmec (4c4-4c5)259
    4c5ATCCATTTCTCAGGAGTTAGCR00880028021Type IV.3
    4d3AATTCACCCGTACCTGAGAACD00223902409Type IV.4CD002 in type IV.4 (IVd) SCCmec (4d3-4d4)1,242
    4d4AGAATGTGGTTATAAGATAGCTACD00236313609Type IV.4
M-PCR 4 (for amplification of ORFs in J1 region of type II, type III, and type V SCCmec)
    kdpB1GATTACTTCAGAACCAGGTCATkdpB1243612415Type II.1kdpB in type II.1 (IIa) SCCmec (kdpB1-kdpB2)287
    kdpB2TAAACTGTGTCACACGATCCATkdpB1215012171Type II.1
    2b3GCTCTAAAAGTTGGATATGCGS0114971517Type II.2SA01 in type II.2 (IIb) SCCmec (2b3-2b4)1,518
    2b4TGGATTGAATCGACTAGAATCGS0130142993Type II.2
    4b3AACCAACAGTGGTTACAGCTTIIE3, M0012457, 21562477, 2176Type IV.2, II.3 (IIE)IIE03 in type II.3 (IIE) SCCmec or M001 in type IV.2 (IVb) SCCmec (4b3-4b4)726
    4b4CGGATTTTAGACTCATCACCATIIE3, M0013182, 28813161, 2860Type IV.2, type II.3 (IIE)
    II4-3GTACCGCTGAATATTGATAGTGATRN061184811871Type II.4RN06 in type II.4 SCCmec (II4-3-II4-1)2,003
    II4-1ACTCTAATCCTAATCACCGAACRN061385013829Type II.4
    3a1ATGGCTTCAGCATCAATGAGZ00433333352Type III.1Z004 in type III.1 SCCmec (3a1-3a2)503
    3a2ATATCCTTCAAGCGCGTTTCZ00438353816Type III.1
    5a1ACCTACAGCCATTGCATTATGV0242656426584Type VV024 in type V SCCmec (5a1-a2)1,159
    5a2TGTATACATTTCGCCACTAGCTV0242772227701Type V
M-PCR 5 (for amplification of gene alleles located in J2 region of SCCmec elements)
    ermA1TGAAACAATTTGTAACTATTGAermA3507835099Type II.1ermA-CN030 or CZ021 in J2 region of type II.1 (IIa) or type III.1 SCCmec (ermA1-mN5)2,756
    cad4ATTGCGATTCTTTCCGATATGGcadB1610716128Type III.1cadB-CN030 or CZ021 in J2 region of type II.1 (IIa) or type III.1 SCCmec (cad4-mN5)1,540
    mN5TTGCTTCGGGACTTACCTCTAGTCN030, CZ02137833, 1764637811, 17624Type II.1, type III.1
M-PCR 6 (for amplification of gene alleles located in J3 region of SCCmec elements)
    ant1CAGACCAATCAACATGGCACCant(4)′5076450744Type II.1mecA-ant(4′) in pUB110 (mA1-ant1)4,952
    pT181-2AGGTTTATTGTCACTACAATTGAtetK3286932847Type III.1mecA-tetK in pT181 (mA1-pT181-2)7,406
    mA1TGCTATCCACCCTCAAACAGGmecA45813, 2546445833, 25484Type II.1, type III.1
Primer sets for PCR used for identification of genes or gene alleles
    1a1ATTCCATATGAAACTAAACGCGTpls1186411841Type I.1pls (CE010) in type I SCCmec (1a1-1a2)1,065
    1a2TAGTGAACCAAATAATGTGCCATTpls1080010823Type I.1
    merA2TCTTCACAGCCTGTGCATGTCATGCCTmerA3987439900SCCmercurymer operon (merA2-merG)1,546
    merGTGATACCGCGAATGAATCAAAGGTCZ0464141941396SCCmercury
    mN21TCATCTTTAACTACGATGGTGTCZ0554784847869SCCmercuryJ region in SCCmercury (mN21-mN22)577
    mN22ACTACAGCCATCTTCAGATAGACZ0564842448403SCCmercury
Primer sets for amplification of type II.4 SCCmec carried by RN7170
    cR1AAGAATTGAACCAACGCATGAorfX5784757827Type II.1orfX-mecA (cR1-mA3)11,756b
    mA3AACGTTACAAGATATGAAGTGGTAAATGGTAmecA4609346123Type II.1
    mA2AACGTTGTAACCACCCCAAGmecA4609846078Type II.1mecA-ermA (mA2-ermA1)11,020b
    ermA1TGAAACAATTTGTAACTATTGAermA3507835099Type II.1
    ermA3TGGGTAAACCGTGAATATCGTGTermA3521435192Type II.1ermA-ccr gene complex (ermA3-2AJ1)9,937b
    2AJ1ATTAGCCGATTTGGTAATTGAANoncoding region between RN01 and RN0242704249Type II.4
    βcATTGCCTTGATAATAGCCITCTccrB22872308Type II.4ccr gene complex chromosomal region flanking SCCmec (βc-cL4)15,000c
    cL4CAGTCGCATCAAATGTCTCTAATGChromosomal region flanking to SCCmec32183241Type II.1
  • a Accession numbers deposited in DDBJ/EMBL/GenBank database used as reference sequences for SCCmec elements and SCCmercury are as follows: type I.1 SCCmec, AB033763; type II.1 SCCmec, D86934; type II.2 SCCmec, AB127982; type II.3 (type IIE) SCCmec, AJ810120; type II.4 SCCmec, AB261975; type III.1 SCCmec and SCCmercury, AB037671; type IV.1 SCCmec, AB063172; type IV.2 SCCmec, AB063173; type IV.3 SCCmec, AB096217; type IV.4 SCCmec, AB097677; type V SCCmec, AB121219; type VI SCCmec, AF411935.

  • b The sizes of DNA fragments estimated from the nucleotide sequence of the type II.1 SCCmec element are given. The sizes of DNA fragments amplified from chromosomal DNA of RN7170 were judged to be the same as those from chromosomal DNA of N315 by agarose gel electrophoresis.

  • c The combination of the primer pair βc and cL4 should amplify the DNA fragment of 24 kb from chromosomal DNA of N315.