TABLE 1.

Oligonucleotide primer pairs used

GenePrimerSource or referenceProduct size (bp)
DesignationSequence (5′-3′)
erm(B)ERMB1GAAAAGGTACTCAACCAAATA 32 639a
ERMB2AGTAACGGTACTTAAATTGTTTAC 32
tet(M)TETM2GAACTCGAACAAGAGGAAAGC 23 740a
TETM3ATGGAAGCCCAGAAAGGAT 23
tet(M)O6GGTACTTGAAAAGAACGGGAG 5 630
TETM11TTCACCTTAGTATTTTTCCACTGThis study
tet(M)O6GGTACTTGAAAAGAACGGGAG 5 740
TETM12ATACGAGTTTGTGCTTGTACGCCThis study
orf14 b M1cACAGCATTTAGTGGGAGCAGOur laboratoryd1,397
tet(M)O7cCGGTAGTTTTTCCTGCATCAAC 5
tet(K)tetK-upTATTTTGGCTTTGTATTCTTTCAT 34 1,159
tetK-revGCTATACCTGTTCCCTCTGATAA 34
tet(L)tetL-upATAAATTGTTTCGGGTCGGTAAT 34 1,077
tetL-revAACCAGCCAACTAATGACAATGAT 34
tet(O)TETO1AACTTAGGCATTCTGGCTCAC 23 519
TETO2TCCCACTGTTCCATATCGTCA 23
int int-forGCGTGATTGTATCTCACT 12 1,046
int-revGACGCTCCTGTTGCTTCT 12
xis xis-forAAGCAGACTGAGATTCCTA 2 193
xis-revGCGTCCAATGTATCTATAA 2
tndX tndX-1ATGATGGGTTGGACAAAGA 1 610
tndX-2CTTTGCTCGATAGGCTCTA 1
tnpR O21CCAAGGAGCTAAAGAGGTCCC 25 1,528
O22GTCCCGAGTCCCATGGAAGC 25
tnpA O23GCTTCCATGGGACTCGGGAC 25 2,115
O24GCTCCCAATTAATAGGAGA 25
orf24 b TN6-revCCATCAAACATTCATTCAGCOur laboratory3,356/3,358e
orf20 b J13GGTTTTGTGGTTAGTTTTOur laboratory
orf23 b 23-forATTCAGATGTTCAAAGAGCAGATGThis study3,188/3,178/3,180f
orf20 b J13GGTTTTGTGGTTAGTTTTOur laboratory
orf20 b J12CCCATTGAAGACGCAGAAGTOur laboratory4,828/7,689/4,841f
orf15 b J15-revAAAGGAAGCCGATAGGATAAAOur laboratory
orf15 b J15TTTATCCTATCGGCTTCCTTTOur laboratory6,511/3,956/3,955f
tet(M)O7CGGTAGTTTTTCCTGCATCAAC 5
tet(M)TETM2GAACTCGAACAAGAGGAAAGC 23 3,835/9,099e
xis xis-revGCGTCCAATGTATCTATAA 2
tet(M)TETM2GAACTCGAACAAGAGGAAAGC 23 4,471
tndX tndX-2CTTTGCTCGATAGGCTCTA 1
  • a Also used to obtain a specific probe.

  • b From the reported organization of the Tn916 element (accession no. U09422 ).

  • c The M1/O7 primer pair was used to detect the regulatory region upstream of the tet(M) gene.

  • d Montanari et al., unpublished data.

  • e The former product size was expected according to the reported sequence of Tn6002 (accession no. AY898750 ), with the latter according to the reported organization of Tn3872 (20, 25).

  • f The first product size was expected according to the reported sequence of Tn5397 (accession no. AF333235 ), the second according to the reported sequence of Tn6002 (accession no. AY898750 ), and the third according to the reported organization of Tn3872 (20, 25).