TABLE 2.

Primers used for PCR amplification and sequencing of fusA alleles

PrimeraSequence (5′ → 3′)UsebNucleotide locationc
FusAFATGGCTAGAAAGTTTCCTTTGGAP, S98757-98779
FusARAGTATTATTGGATTAGCAGGGTCAP, S99943-99920
FusAF2TGACCCTGCTAATCCAATAATACTP, S99920-99943
FusAR2AGCTGGAACTTGCTCATAGTGATP, S100790-100767
FusASeq1AGCTGAAACTGATGAAGAATTAAS99410-99432
FusASeq2TTAATTCTTCATCAGTTTCAGCTS99432-99410
FusASeq3GCGTTTAAGATGGCTGGTTCS100488-100507
FusASeq4GCCATCTTAAACGCCATCTCS100501-100481
  • a Synthesized by Scandinavian Gene Synthesis AB, Köping, Sweden.

  • b P, PCR; S, sequencing.

  • c Locations of the primers according to the nucleotide sequence of the whole sequenced genome of C. difficile strain 630 (accessible at http://www.sanger.ac.uk/Projects/C_difficile/).