TABLE 1.

Oligonucleotide primers used for PCR and nucleotide sequence determination of amplicons

Forward primerReverse primer
NameNucleotide sequenceNameNucleotide sequence
tetMF1GCATAAGATTTCAGAATTGTTC(C/T)CTGTTCCtetMR1GTAATATCGTAGAAGCGGATCACTATCTGAG
tetMF2CCTTTATAGTGGAGTACTACATTTACGAGATTCGGtetMR2CAACGGAAGCGGTGATACAGATAAACCAATGG
tetOF1GAACAGGAAGAAAACAGGAGATTCCAAAACGtetOR1GGGTCGCCATCTGAAATTTCTGTAAGTGCCC
tetOF3GTGCGTATATATAGCGGAACATTGCATTTGAGGtetOR3CTTCCAATAGGGAGCGGCTCTATGGACAACCCG