TABLE 1.

Primers used for PCR amplification of target genes

Primer nameDescriptionSequence
L3UP1Primes upstream of rplCAACAGTTGACGCTTTAATGGGC
L3DOWN1Primes downstream of rplCGGCTCAATACCGAATACTGCATCGC
L3regupsmaPrimes upstream of rplCCCCGGGCTCGAAAATAGTTGATCTGC
L3regdownsmaPrimes downstream of rplCCCCGGGAGCTGTCAGCATTAGTGATA
L2FPrimes upstream of rplBCTTAAAGAAGGATCAATCGAC
L2RPrimes downstream of rplBCCCTTCTTATTATGTGCGTGCAG
L4FPrimes upstream of rplDCACAGAAAACAAAGTTATCTTAGTAA
L4RPrimes downstream of rplDGGTTTGTAATTCATGATATTAACACTT
L10FPrimes upstream of rplJCGTGATGATCTATGATCTTTCAGC
L10RPrimes downstream of rplJCGCTTCATGATTTGTTCATGATTAGGC
L22FPrimes upstream of rplVGATAATATCTATTAAGTAGAGGAGGAC
L22RPrimes downstream of rplVACCCACAGTATTCCCTCCTTAAAAG
L27FPrimes upstream of rpmAGGATGAAGCGCAACTAATTCTTC
L27RPrimes downstream of rpmACGATTAGAGGCTCTTATGCAGTTG
VU1Primes upstream of domain V of rrlGAAAGGCGTAATGATTTGGG
VLAPrimes downstream of rrlATGTGAAAAAGACTGGATGACAG
VLBPrimes downstream of rrlBCGTTGACATATTGTCATTCAG
VLCPrimes downstream of rrlCCATACTTAGACAATCGAAAGTG
VLDPrimes downstream of rrlDCTAGGCCGGCAATATGTAAG
VLEPrimes downstream of rrlECAGGTGCATTGAGAGAATTTG
VLFPrimes downstream of rrlFTCCACAGGTAGGACTCGAAC