TABLE 1.

Primers used in this study

Primer nameSequence (5′→3′)PositionGenBank accession no.
rob-1FTGTTGCAATCGCTGCC2952-2968DQ840517
rob-1RTTATCGTACACTTTCCA3392-3409DQ840517
rob-1DAATTGGTTGGACAATAACGCA3332-3353DQ840517
rob-1UATCGTCATGCCTTTGCCAACG3043-3064DQ840517
MAP-1GCTCTCTAATTCTTTCGATAA1617-1638DQ840517
MAP-2TTTTGAAGAAAGCGACCTACC550-571DQ840517
MAP-3TTCTGTGATGTCTGCTGAAAG1085-1106DQ840517
MAP-4TAAAGCATTGGTATTAAAGGC3777-3798DQ840517
MAP-5GATTTTATCAACTCAACGTGG1461-1482DQ840517
HPS-FGTGATGAGGAAGGGTGGTGT440-459M75065
HPS-RGGCTTCGTCACCCTCTGT1243-1260M75065
univ1CTGGCTCAGGACGAACGCTG30-49EF221612
univ2GTTGCGCTCGTTGCGGGACT1112-1131EF221612