TABLE 1.

Primers used in the updated version of SCCmec multiplex PCR

Primer namePrimer sequence (5′→3′)Primer specificity (SCCmec type, region)Amplicon size (bp)Reference
CIF2 F2TTCGAGTTGCTGATGAAGAAGGI, J1 region495 13
CIF2 R2ATTTACCACAAGGACTACCAGC 13
ccrC F2GTACTCGTTACAATGTTTGGV, ccr complex449This study
ccrC R2ATAATGGCTTCATGCTTACCThis study
RIF5 F10TTCTTAAGTACACGCTGAATCGIII, J3 region414 13
RIF5 R13ATGGAGATGAATTACAAGGG 13
SCCmec V J1 FTTCTCCATTCTTGTTCATCCV, J1 region377This study
SCCmec V J1 RAGAGACTACTGACTTAAGTGGThis study
dcs F2CATCCTATGATAGCTTGGTCI, II, IV, and VI, J3 region342 13
dcs R1CTAAATCATAGCCATGACCG 13
ccrB2 F2AGTTTCTCAGAATTCGAACGII and IV, ccr complex311This study
ccrB2 R2CCGATATAGAAWGGGTTAGCThis study
kdp F1AATCATCTGCCATTGGTGATGCII, J1 region284 13
kdp R1CGAATGAAGTGAAAGAAAGTGG 13
SCCmec III J1 FCATTTGTGAAACACAGTACGIII, J1 region243This study
SCCmec III J1 RGTTATTGAGACTCCTAAAGCThis study
mecI P2ATCAAGACTTGCATTCAGGCII and III, mec complex209 13
mecI P3GCGGTTTCAATTCACTTGTC 13
mecA P4TCCAGATTACAACTTCACCAGGInternal positive control162 13
mecA P7CCACTTCATATCTTGTAACG 13