TABLE 1

Primers for genotyping pfcrt, pfmdr1, and k13-propeller genes

Gene (ID)PCR roundPrimerSequence (5′–3′)Primer binding regionSize (bp)
StartEnd
pfcrt (PF3D7_0709000)PrimaryPfcrt_Outer P1CCGTTAATAATAAATACACGCAG−86−64547
Pfcrt_Outer P2CGGATGTTACAAAACTATAGTTACC436460
SecondaryPfcrt_Inner P1TGTGCTCATGTGTTTAAACTT307327145
Pfcrt_Inner P2CAAAACTATAGTTACCAATTTTG429451
pfmdr1 (PF3D7_0523000)PrimaryPfmdr1(1)-N1FTTAAATGTTTACCTGCACAACATAGAAAATT137167612
Pfmdr1(1)-N1RCTCCACAATAACTTGCAACAGTTCTTA722748
SecondaryPfmdr1(1)-N2FTGTATGTGCTGTATTATCAGGA183204526
Pfmdr1(1)-N2RCTCTTCTATAATGGACATGGTA687708
PrimaryPfmdr1(2)-N1FAATTTGATAGAAAAAGCTATTGATTATAA30193047880
Pfmdr1(2)-N1RTATTTGGTAATGATTCGATAAATTCATC38713898
SecondaryPfmdr1(2)-N2FGAATTATTGTAAATGCAGCTTTA30683090799
Pfmdr1(2)-N2RGCAGCAAACTTACTAACACG38473866
k13-propeller (PF3D7_1343700)PrimaryPfK13_outFGGGAATCTGGTGGTAACAGC65842,097
PfK13_outRCGGAGTGACCAAATCTGGGA21422161
SecondaryPfK13_inF2TCAACAATGCTGGCGTATGTG13981418501
PfK13_inR2TGATTAAGGTAATTAAAAGCTGCTCC18731898