TABLE 2

Primers used in this study

Primer usePrimer nameSequence (5′–3′)
cyp51C amplification and sequencingAflaCYP51CF1CTGTTGCAGAGCCGTTGATG
AflaCYP51CR1CAAAGAGCGACACATAAG
AflaCYP51CF2GGTAATGTCTGGTCATAGG
AflaCYP51CR2ATGAGCTTGGAATTGGG
AflaCYP51CF3CGAATTCATCCTCAATGG
AflaCYP51CR3GTCTCTCGGATCACATT
AflaCYP51CF4GGAACTCTACCAAGAGCA
AflaCYP51CR4CCTAGATACAGCTAGATACCC
Real-time PCRAflMDR1 ForwardTTTGTCGGGAGTCAGTGGTGTA
AflMDR1 ReverseCCAAGGGTTGTGCTAGTCATCA
AflMDR2 ForwardAGTGCTCTGGCTGCTTTGCT
AflMDR2 ReverseCGATGGGCAATGCTGATTG
AflatrF ForwardGTCACGTGGAGAAGCGAAGTC
AflatrF ReverseAGCAGAAAGGCGCTGCAT
Aflmfs1 ForwardTGCTGATCACGGCGCTATT
Aflmfs1 ReverseGGGAGACAATCCCTCCGAAT
Aflcyp51A ForwardGCCGGTCGAGCATTGC
Aflcyp51A ReverseGCGAATTCTGCAGTGAGCTTT
Aflcyp51B ForwardAGGAACCAACAGCCCGTATCT
Aflcyp51B ReverseTTCGCCAATGCACCTATGAC
Aflcyp51C ForwardTCCGTCTTCATTCGTCCATTC
Aflcyp51C ReverseCCGGGAGCGGGTTCTT
Aflact1 ForwardCGAGGAGCACCCGGTTCT
Aflact1 ReverseCACGGTTGGACTTAGGGTTGA