TABLE 3

Primers

NameSequenceaPurpose
DXR F1TTATTAATACATATGCAAAAACGTCTGACATTGCTCAmplification of dxr fragment
DXR R2TATCTAGAAGCCGTCGCTCTTCGACACAmplification of dxr fragment
rhaFCACGTTCATCTTTCCCTGGTConfirmation of fragment insertion and plasmid recombination
200-MCS-RAACACTTAACGGCTGACATGGConfirmation of insertion of fragment in plasmid
DXR R4AGGCCCTTGTTCATCATCGConfirmation plasmid recombination in K56-2dxr
dxr-exprFAATAATAATCATATGCAAAAACGTCTGACATTGCTCAmplification of dxr for complementation
dxr-exprRAATTCTAGATTCATGAGCACCCCATTCAGACAmplification of dxr for complementation
pDA-FGCAACTGGTCCAGAACCTTGConfirmation of dxr insertion into pDA
rha1RCTCTCATCCGCCAAAACAGCConfirmation of dxr insertion into pDA
  • a Restriction sites are underlined.