TABLE 2

Candia auris FKS1 sequence analysis results

FKS1 hot spotNucleotide sequence (nta positions or mutation)Amino acid sequence (type)Isolates
FKS1 HS1TTCTTGACTTTGTCCTTGAGAGATCCT (1903–1929)FLTLSLRDP (WT)All except 4 (mentioned below)
TTCTTGACTTTGTTCTTGAGAGATCCT (C1916T)FLTLFLRDPb (S639F)VPCI 1133/P/13, VPCI 265/P/14, VPCI 462/P/14, VPCI 471a/P/14c
FKS1 HS2GACTGGATTAGACGTTATACCTTG (4048–4071)DWIRRYTL (WT)All
  • a nt, nucleotide.

  • b The boldface F represents the mutated amino acid.

  • c Isolates VPCI 1133/P/13 - R, VPCI 265/P/14, VPCI 462/P/14, and VPCI 471a/P/14 - R were resistant to all the echinocandins tested.