TABLE 7

PCR primers

Primer namePrimer sequencea
msbA-f2AAACGTCTCGAATTCATGCATAACGACAAAGATCTCTC
msbA-r2AAAATCTAGAtCATTGGCCAAACTGCATT
PBAD-msbA-fAAAAGAGCTCGATGCATAATGTGCCTGTC
PBAD-msbA-rAAAAGAGCTCGTTCACCGACAAACAACAG
msbA-KO-noPkan-fTGGATAACGGGTAGAATATGCGGCTATTTCAACAAATGCTGGTTTTTTGAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCAGGAGGAATTCATGATTGAACAAGATGGATTGC
msbA-KO-kan-rGGCAGCAATAGCCGCCACAAAGGGGATTCACCAGACCAGATTTTTTCGATCATATGAATATCCTCCTTAGTTCCTATTC
SmR-fAAAAAAGACTCCCCGTCAGAAGCACACGGTCACACTG
SmR-rAAAAAAAAATCGAGACCCCTGCTTATCCACGGAATCT
msbA-fATGCTGGTTTTTCATATGCATAACGAC
msbA-rCGGGATCCTCGAGTCATTGGCCAAACTGCATTTTG
  • a Bolded sequence at 3' ends is homologous to template sequence. Additional bolded sequence in msbA-KO-noPkan-f primer introduces an FRT recombinase site.