TABLE 2

List of primers used in this study

Purpose and nameSequence (3′–5′)
CgEPA3 gene cloning
 pGREG_CgEPA3_I_FWTGCTATTAGGTCAACCTTGTAACAGCTGCCATAGCTATTCGAACTATAGCTTAAG
 pGREG_CgEPA3_I_RevCAGTTGCCACGATGACTAGTCAGCTGGAGCTCAGTACATTAATCAATACAGTGCG
 pGREG_CgEPA3_II_FWGTCATCGTGGCAACTGTGATTTTCTTTCTAGATTCCTACT
 pGREG_CgEPA3_II_RevCGTGAAAAAAAGACTAAATTCAGCTGGAGCTCAGTACATTAATCAATACAGTGCG
pGREG576 GAL-to-PDCI promotor replacement
 pGREG_PDCI_ FWTTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCAGCATTTTTATACACGTTTTAC
 pGREG_PDCI_RevGAAAAGTTCTTCTCCTTTACTCATACTAGTGCGGCTGTTAATGTTTTTTGGCAATTG
CgEPA1, CgEPA3, CgEPA9, CgEPA10, AWP12 and AWP13 gene disruption
 ΔCgEPA1_FWGCACTAGTCGCCGGACAAAATCAAACCAATTAACGTTTCTGATTTAGAGTTCTTACTTCTTTTTCGAAAC
 ΔCgEPA1_RevGGTCGGAGTGCTACATTTTGGTCCTTTATATTATTGAAGGTATCAAATCGTAACATTTTCGACACCACCG
 ΔCgEPA3_FWGCACTAGTCGCCGGTAACTAAAAAAAAGAAAACATTGAAAAAGACTAGTTAAATTAAGCTAATACTACCA
 ΔCgEPA3_RevGGTCGGAGTGCTACATTAAGACAAGGGAATTAAAGATAATACTATAACAAAGAGAAATAAGTAACTAATT
 ΔCgEPA3_SAT1_FWATCATTCCTGGTTTGACAATGGAACTTTACTCTTACCCTATTGTCAGTGGTACTCCTCCCATGGACGGTGGTATGTTTTA
 ΔCgEPA3_SAT1_RevGCTTCGAAGCTTTACCCTTGTACTCTGAAAAATTAGGGATATTAAAGACAGAACTAGAGGTTAGGCGTCATCCTGTGCTC
 ΔCgEPA9_FWTCACTAAGTGGATGAAATGCAGAAAGAATACAATTTAACCCTCTTCAATGCGATCCGGCGGCCGCTGATCACG
 ΔCgEPA9_RevCAACTGCCAAAGGGTTCACAAGTTGAATACCAGGCCAACCATCATCAGTGGCAGGGCGACATCGTGAGGCTGG
 ΔCgEPA10_FWGCACTAGTCGCCGGGCTAATACCTGATCGTAGACTATATTACTTCATAAAACTTTTGTTACCTACCCGTA
 ΔCgEPA10_RevGGGAAAGAAAAATCAACCACATTGGCAAAACGTAGACATCTTGTCAACTGCCAAAGCATCGTGAGGCTGG
 ΔCgAWP12_FWTACTTAAAATTTCCTTTCTCAATCAACAAAAATATCCATTAACTGAAAAAGAATACGGCGGCCGCTGATCACG
 ΔCgAWP12_RevTATCAATGTTCATATTGAAAGAAACAGCCTATCTAAAAATCATGGCTGGACGAACGCGACATCGTGAGGCTGG
 ΔCgAWP13_FWATTACGTGACAAAAGACAGATAAAGGAATTCTAAATATCCATCTACAAGACCATTCGGCGGCCGCTGATCACG
 ΔCgAWP13_RevCCTATCTAAAAATCATGGCTGGACGAACGTTTGTATTACTGTACATGTTGGGCATTCGACATCGTGAGGCTGG
 ΔCgEPA1_conf_FWTAAATAAGTTTTTATCTCGACC
 ΔCgEPA1_conf_RevGGTTTTCATTGACCGAAG
 ΔCgEPA3_conf_FWCGGAACTTCATTGGTATG
 ΔCgEPA3_conf_RevCATACCAATGAAGTTCCG
 ΔCgEPA3_SAT1_conf_FWCCCAGAACCCATTTGGTTATCC
 ΔCgEPA3_SAT1_conf_RevGCCCAGATAACAACACAAGTCC
 ΔCgEPA9_conf_FWCTTTTGGTATCTGACTCTGTTAT
 ΔCgEPA9_conf_RevGGTCCCAAGAGATTTTACC
 ΔCgEPA10_conf_FWTGTCTCAGTCTATGGCTTTC
 ΔCgEPA10_conf_RevCTCAAGTGTCTCCCAACA
 ΔCgAWP12_conf_FWGCCTGTGGATATTGCTACT
 ΔCgAWP12_conf_RevGTCACTGATTGAAAGTTCTCG
 ΔCgAWP13_conf_FWGTATATTTTCAAGTGCTGCAT
 ΔCgAWP13_conf_RevCTACCGTGGTTTCACTTG
RT-PCR experiments
 CgEPA1_FWTTGATTGCTGCAGAAGGGATT
 CgEPA1_RevATGGCGTAGGCTTGATAATTTCC
 CgEPA3_FWGTTCCTGTCACCAGCACCATATACTA
 CgEPA3_RevCCTTGGCAACTAGGTGTTTGG
 CgCDR1_FWGCTTGCCCGCACATTGA
 CgCDR1_RevCCTCAGGCAGAGTGTGTTCTTTC
 CgACT1_FWAGAGCCGTCTTCCCTTCCAT
 CgACT1_RevTTGACCCATACCGACCATGA