Table 1.

PCR primer sequences for β-lactamase gene detection

Oligonucleotide identificationSequenceSize (bp)Referencea
Bacteroides fragilis blaCepA-FTTTCTGCTATGTCCTGCCC780b3
Bacteroides fragilis blaCepA-RATCTTTCACGAAGACGGC
Bacteroides fragilis blaCfiA-FTCCATGCTTTTCCCTGTCGCAGTTAT72845
Bacteroides fragilis blaCfiA-RGGGCTATGGCTTTGAAGTGC
Bacillus cereus blaI-FGTGGATGAAAGGAAATGCTACG156b28
Bacillus cereus blaI-RATTGCGATGATAATTGGTGCTC
Bacillus cereus blaII-FGCGTCAGCACATTCTCAATCG165b12
Bacillus cereus blaII-RATCCAGGGAAAGGACATACAGAAG
Bacillus cereus blaIII-FTGCGGGTGTACCAAAAGGATGGG464b24
Bacillus cereus blaIII-RGGGTGGTGCAAGTGGGAAAGCAA
Bacteroides vulgatus blaCfxA-FACTCTAACTATACATCTCCTCTTG19334
Bacteroides vulgatus blaCfxA-RTAACCTGAACCTGTCTTATGC
Bacteroides uniformis blaCblA-FGGTGGAAGAGCAGTTAGG18143
Bacteroides uniformis blaCblA-RCTGATAGGCTACCGAAGTC
Bacillus mycoides blaC1-FATTGCTGAGGCTGCTGTTC173b18
Bacillus mycoides blaC1-RTCACGAATGTCTCCTGGAATAG
Clostridium perfringens bla-FGAGGAAAAGCAGAAAGAAGAGAAG14541
Clostridium perfringens bla-RCATGAGCAAAGCGGTTACTATTAC
Bifidobacterium longum bla-FGGTGCCTTCGGGGATGTG19427
Bifidobacterium longum bla-RCCCTTGACCAAGCGTTCG
Enterococcus gallinarum blaAmpC-FCGTTACCCGTGGCAGAAG13623
Enterococcus gallinarum blaAmpC -RGCGAGCATCACAATACCG
Enterococcus gallinarum blaTEM-FTTCCGTGTCGCCCTTATTC149b22
Enterococcus gallinarum blaTEM-RAGGATCTTACCGCTGTTGAG
Enterococcus faecalis blaSHV-FTTATATTCGCCTGTGTATTATCTC18640
Enterococcus faecalis blaSHV-RATGGGAAAGCGTTCATCG
Desulfovibrio vulgatus bla-FCTGATAGCCCACGAAGAC1728
Desulfovibrio vulgatus bla-RGCCCAACCTGAAATACAC
Desulfovibrio desulfuricans DES-1-FCACCGCCAATGATGTAGG11132
Desulfovibrio desulfuricans DES-1-RGATCCCGTGAGGTAGAGG
Sphingomonas wittichii bla-FCGCCGTGAGCATCCAATAG819
Sphingomonas wittichii bla-RGCTTCGCTGTCGTCCTATC