Table 2.

Primers used in the study

PrimerNucleotide sequence (5′–3′)
MexB2-FAACGTGCAGATTTCCTCCGG
MexB2-RTGTACCTGGGCGAACAGTAC
INA-axyB-2FGGGGAATTCTCTATCGCCAGTTCTCCATCAa
INA-axyB-2RGGGAAGCTTGCGCACGTACCATTTGTCCAb
AL-BAP1-F1TGTACCTGTTCCTGCAGAAC
M14FcCCAGGGTTTTCCCAGTCACGA
M14RcGCGGATAACAATTTCACACAGGA
AL-BAP1-R1AAGTACACGTCGTTGGACAG
RT-INA-R0ACCATGTCGCCATCCTTGTT
RT-INA-F1GTGTTCATCCCGATGGCGTT
  • a The EcoRI restriction site introduced into the primer is underlined.

  • b The HindIII restriction site introduced into the primer is underlined.

  • c Primer designed in pINAP1.