Table 2.

List of novel primers used

Experiment and primerSequence (5′-3′)
PCR and sequencing of cyp51B
    cyp51B-F1ACACTCAGCCTACCTTTATTCCCT
    cyp51B-F2CTCACTACGCCTGTTTTTGGTC
    cyp51B-F3CATGGTCTGGAACCTCATGTC
    cyp51B-F4GGTTAGTTAGCAAGGGCACCA
    cyp51B-R1ACACATAAATTTGGCAGCGA
    cyp51B-R2GGTTATGGTACAACTCTGCGAAT
    cyp51B-R3ATATGAAGTACCATCCACAGCCA
    cyp51B-R4TTCCATGCAAGTCTATCAAGAAGAG
PCR and sequencing of 5′ upstream region of cyp51A
    cyp51Apro-1aGTGACAAGCGAAGATTCCACACAT
    cyp51Apro-2ACAACAGAAGCGACTTTCTCTTCAG
    cyp51Apro-3GTCTTTAGATTCGGTGGACGC
    cyp51Apro-4GCTGCCGCTGAGGAACATATG
    cyp51Apro-5a,bGTAAGCCATAGCATCGGCACCAT
    F12776PR5walk1GCCTAGAATATGGCAGTCACTGC
    F12776PR3walk1TTATACTACCCTCCAGCGGC
Gene copy no. determination (cyp51A)
    cyp51AgDNAq1AGAGGTCTATAGTCCATTGACGA
    cyp51AgDNAq2bTCCTTCTCAATAAGTGGCACA
    benA-gDNA-1ATTCAGGAGTTGTTCAAGCG
    benA-gDNA-2GTACTGCTGGTATTCGGAGAC
Gene expression
    cyp51AqPCRforTGCAGAGAAAAGTATGGCGA
    cyp51AqPCRrevCGCATTGACATCCTTGAGC
    cyp51BqPCRforAGCAGAAGAAGTTCGTCAAATAC
    cyp51BqPCRrevTCGAAGACGCCCTTGTG
    MDR1forTTCCCTTGTTCACAATTCTCTTCG
    MDR1revTGACATAGACTGTGACAAACTCG
    MDR2forTTTAGCTCCACCGGGTTTG
    MDR2revTCGAAAGACCGAACATGCTTGA
    MDR3forTCTGATGGCGGTCATCACT
    MDR3revATATCCATCCCCCAGGC
    MDR4forTATGGCTTAGTTTGTGTCACCGA
    MDR4revAGAGCAATTCGTTGCTTCTG
    atrF-forAGAGAAATCGGACAACTGCTGA
    atrF-revCCTCGTCGCAGATAGTCTTGTA
    benA-forCTGTATCGACAACGAGGCTCT
    benA-revAGTTGAGCTGACCAGGGAAA
  • a Primer used for both PCR and sequencing.

  • b Primer used for 5′ RACE.