Table 1.

Primers used in this study

PrimerSequence (5′–3′)Positiona or amplicon size (bp)Source or reference
Tn1FGGCACTGTTGCAAATAGTCGG10326–10346This study
Tn1RTTGCTGCTTGGATGCCCGAGG11981–12001This study
Tn2FCCGGGTGACGCACACCGTGGA11784–11804This study
Tn2RTCATTTACCAACTGACTTGAT12863–12883This study
Tn3FTTATTCGCTTTGTGAAAGGCG12837–12857This study
Tn3RTCCAGACGGCCACATTGGAGG14817–14837This study
Tn4FTCAACGACCTCCTCCAATGTG14807–14827This study
Tn4RACCGCATGGGTTGTGGCATCC16787–16807This study
Tn5FGGATGCCACAACCCATGCGGT16787–16807This study
Tn5RACAATAAGATTGTTGTACTTT18813–18833This study
Tn6FTATGGGCAGGGCGAAGCGCTA18792–18812This study
Tn6RTTTGAGTAAACTACTCTTTCC20773–20793This study
Tn7FCGTATTGGTCTTGTGGGTGAT20743–20763This study
Tn7RGTGAAATCTGCCCATAGAACA22722–22742This study
Tn8FGGGAAAATGATTTGAAAATTA22589–22609This study
Tn8RCTGCTATTGTGCCTTTAATTA24589–24609This study
Tn9FTTGTTCTTCTAACCTAGTAAT24572–24592This study
Tn9RCACTGTTGCAAAGTTAGCGAT25584–25604This study
armAFCAAATGGATAAGAATGATGTT77413
armARTTATTTCTGAAATCCACT77413
rmtA.FATGAGCTTTGACGATGCCCTA756This study
rmtA.RTCACTTATTCCTTTTTATCATG756This study
rmtB.FATGAACATCAACGATGCCCT76936
rmtB.RCCTTCTGATTGGCTTATCCA76936
rmtC.FCGAAGAAGTAACAGCCAAAG71110
rmtC.RATCCCAACATCTCTCCCACT71110
rmtD.FCGGCACGCGATTGGGAAGC40110
rmtD.RCGGAAACGATGCGACGAT40110
rmtE.FATGAATATTGATGAAATGGTTGC8189
rmtE.RTGATTGATTTCCTCCGTTTTTG8189
U7-L12ACACCTTGAGCAGGGCAAAGSGI1 left junction2
LJ-R1AGTTCTAAAGGTTCGTAGTCGSGI1 left junction2
104-RJTGACGAGCTGAAGCGAATTGSGI1 right junction2
C9L2AGCAAGTGTGCGTAATTTSGI1 right junction2
L1GGCATCCAAGCAGCAAG5′CS of class 1 integron26
R1AAGCAGACTTGACCTGA3′CS of class 1 integron26
  • a That is, the position in plasmid pMUR050 (AY522431).