Table 2.

Primers used in this study

Name of primerFig. 2 lane no.Sequence (5′-3′)Reference
KPC-A1CTGTCTTGTCTCTCATGGCC11
KPC-B2CCTCGCTGTGCTTGTCATCC11
3098U3TGACCCTGAGCGGCGAAAGC11
4914L4GAAGATGCCAAGGTCAATGC11
TnpA-178U5CTTGCAGATCGGCTACTTCAThis study
TnpA-1198U6CGCCATCTTCGTCCACTGTAThis study
TnpA-2537L7GCCCTGCGTCATTTCCTTCAThis study
ISKpn7-24U8CCCACCCCAGCGAAGTAAAACThis study
ISKpn7-1916L9GACCCACTTTACCCCTGAATThis study
ISKpn6-82U10CGTCGGCGCCAAGGATACCAThis study
ISKpn6-1429L11ATCTGCTGCCCCCTTCTCTGThis study
141R-612TCACCGGCCCTCACCTTTGG11
EcoRI-out13CACCCGACCTGGACGAACTA11
Delta SHVaAAGATCCACTATCGCCAGCAG4
Delta SHVbATTCAGTTCCGTTTCCCAGCGG4
Pre-TEM1GTATCCGCTCATGAGACAATA4
Pre-TEM2TCTAAAGTATATATGAGTAAACTTGGTCTG4
CTX-MACGCTTTGCGATGTGCAG4
CTX-MBACCGCGATATCGTTGGT4
VIM-BATGGTGTTTGGTCGCATATC11
VIM-FTGGGCCATTCAGCCAGATC1
IMP-2004AACAYGGYTTGGTDGTTCTTG1
IMP-2004BGGTTTAAYAAAACAACCACC1
OXA-9ATTCGTTTCCGCCACTCTCCC4
OXA-9BACGAGAATATCCTCTCGTGC4