Table 2.

Primers used in this study

Primer nameSequence (5′ → 3′)aLength (bp)Purpose
SmeRv-FGATGGTACCGCCACGCTGCTGAC1,308Cloning
SmeRv-RCAGAATAAGCTTGCCGCTGCTTTCC
SmeU1-FCGATTAAGCTTCGGCAATGAAG1,341Cloning
SmeU1-RACGTTCTAGAGTGGTATTGGGG
SmeU2-FGATGATATCCATCGCGTTCATCGCC1,074Cloning
SmeU2-RTGACAGAGCTCGCCAGCACCAG
SmeX-FGGCTCTAGAGAAATCAGCGAAG1,591Cloning
SmeX-RAGAAGAAAGGTACCGAAGCCAC
YW5-FGCAAGCTTCAAAGCGGATCGCCAG697Cloning
YW5-RCAGCATCTAGAAGGCAAGCGAG
YW3-FATCTAGACGGAAGTCCCCCATGAG655Cloning
YW3-RGCCGGAATTCACCAGCAGCGAG
SmeBQ-FCGCCATCTCGCTGCTGTTC198qRT-PCR
SmeBQ-RATGCCGTTCTTCGCTGCC
SmeCQ-FGCGATGCCAACAGCGAGACC190qRT-PCR
SmeCQ-RGTCGCCACTTCAGCCACCAG
SmeEQ-FTCCTGCCCAACGAAGACC203qRT-PCR
SmeEQ-RCTTGACGAACGCCATGCC
SmeFQ-FCCCGAGCATCTCGCTGAC207qRT-PCR
SmeFQ-RAAGCCCACCTGGATCGAC
SmeHQ-FGGCTACTCGGCGATCAAC207qRT-PCR
SmeHQ-RCAGGCACAGGAACACCAC
SmeJQ-FGTCAGCCACCAGCAGCAG192qRT-PCR
SmeJQ-RCAGCAGCCACACCACGTC
SmeKQ-FAACTCCGACCCCAGCGAC191qRT-PCR
SmeKQ-RGCGATCATCGAGATCACCGAC
SmeNQ-FCAAGACCTCCACTGCCAAC198qRT-PCR
SmeNQ-RAACAGCCAGATCACCGCC
SmePQ-FGTCAGCCAGTTCCTGTCC191qRT-PCR
SmePQ-RTACTCCATCGTCGCCACC
SmeZQ-FTGTCCAGCGTCAAGCACC218qRT-PCR
SmeZQ-RGCCGACCAGCATCAGGAAG
SmeRvQ-FTCGACGAACGCACGCACC213qRT-PCR
SmeRvQ-RCCCGCTGATGACCGCCAAC
SmeU1Q-FCGGCGAGACCTCGATCAC201qRT-PCR
SmeU1Q-RCAACCATCCAGCAGCGAC
SmeVQ-FGCGTGACAGCGAACTGCC219qRT-PCR
SmeVQ-RTCATCGATCAGCAGCGCC
SmeWQ-FGCCCACACCATCTCGTTCCC221qRT-PCR
SmeWQ-RTAGCCGTTGCCGTTGCCC
SmeU2Q-FGGTCGAGCAGGTACGCCAG153qRT-PCR
SmeU2Q-RACCGCCACCAGCGCATAG
SmeXQ-FTACGACCGCCGCAAGCAACC219qRT-PCR
SmeXQ-RCAGCTCGAAGTAGTTGCGTGCC
rDNA-FGACCTTGCGCGATTGAATG75qRT-PCR
rDNA-RCGGATCGTCGCCTTGGT
  • a Underlining indicates the restriction sites introduced for cloning.