TABLE 1.

Sequences of primers used for specific gene detection

TargetaPrimer namebPrimer sequence (5′ to 3′)Size (bp)Ta (°C)cSource or reference
armAarmA-FAGGTTGTTTCCATTTCTGAG40551This work
armA-RACCTATACTTTATCGTCGTC
rmtArmtA-FCGTGACATAACATCTGTATG33351This work
rmtA-RTTCAAATTCATCAGGCAGTG
rmtBrmtB-FATTGGGATTTTACCTTTGCC29051This work
rmtB-RTATAAGTTCTGTTCCGATGG
rmtCrmtC-FAGATACCAAATCCAACTACG36951This work
rmtC-RTAAGTAGAAGATCACTCTCG
rmtDrmtD-FTCAAAAAGGAAAAGGACGTG50051This work
rmtD-RCGATGCGACGATCCATTC
rmtD-F2dATGAGCGAACTGAAGGAAAAAC74457This work
rmtD-R2dTCATTTTCGTTTCAGCACGTAAA
npmAnpmA-FCTCAAAGGAACAAAGACGG641517
npmA-RGAAACATGGCCAGAAACTC
blaTEMtem1-FATGAGTATTCAACATTTTCGTG86155This work
tem1-RTTACCAATGCTTAATCAGTGAG
blaSHVshv1-FATGCGTTATATTCGCCTGTG86155This work
shv1-RTTAGCGTTGCCAGTGCTCG
blaCTX-Mctx-MU1ATGTGCAGYACCAGTAARGT8035513
ctx-MU2TGGGTRAARTARGTSACCAG
blaKPCUni-KPC-FATGTCACTGTATCGCCGTCT8825517
Uni-KPC-RTTACTGCCCGTTGACGCCC
qnrBqnrB-FCCGACCTGAGCGGCACTGA5235518
qnrB-RCGCTCCATGAGCAACGATGCCT
  • a rmtE was reported after the conclusion of this work, and its analysis was not included.

  • b F, forward; R, reverse.

  • c Ta, PCR annealing temperature.

  • d Primers to amplify the complete rmtD gene.