TABLE 2.

Oligonucleotides used for gene inactivation, gene cloning, and RT-qPCR

OligonucleotideSequence (5′→3′)
Oligonucleotides for gene inactivation
    mexZ
        PCRimexZC1CGTAGCGCTTGAGCTTGTC
        PCRimexZC2GCCCTCACACTGAACGTCCTCACAAGG
        PCRimexZC3TTCAGTGTGAGGGCGTCAATCGTCC
        PCRimexZC4GGTTCGTAGATCGGCATCTC
    PA5471
        PCRi5471C1CTCCTGCGCGAGGTCTAC
        PCRi5471C2GGCGGTCGCGGACAAAGGCTTGATGTA
        PCRi5471C3TGTCCGCGACCGCCAGCTGATCTACG
        PCRi5471C4GATCGCCAGGCGTTTGTT
    PA5470
        PCRi5470C1CTGGAACTGCTCGACATCAA
        PCRi5470C2GAAGCTGTCCTCGATTACCTCGACCTC
        PCRi5470C3TCGAGGACAGCTTCACTGGCTCTTCG
        PCRi5470C4CCGACCTCTTCCACCTGTT
    parS
        PCRiparSC1AGGAGGACGATCTCGATCAC
        PCRiparSC2AGATCTTGGTCGACCACGAAGATCG
        PCRiparSC3GTCGACCAAGATCTTCGAACCCTTTTCG
        PCRiparSC4GCGTTGATCCTGTGCTGTC
    parRS
        PCRiParRSC1GGATTCAGCTTCTGCTCGAC
        PCRiParRSC2AGATCTTCATAGGGTTTCATCGGTCG
        PCRiParRSC3CCCTATGAAGATCTTCGAACCCTTTTCG
        PCRiParRSC4GCGTTGATCCTGTGCTGTC
    pmrAB
        PCRiPmrABC1TGTCGAACTGACCCAGCTAC
        PCRiPmrABC2CTTCCAGGTCACCCATTCCACGGTATC
        PCRiPmrABC3GGGTGACCTGGAAGTGCAGGTGTTCCT
        PCRiPmrABC4GTGCTGAGCTCCTCGATCTT
Oligonucleotides for complementation of parRS
    CloparRSC1GAGGGAAAAGCAGAAGTCACC
    CloparRSC2CGAGGTGTCCCATGCTAGG
Oligonucleotides for RT-qPCR
    uvrD1GCAGCCTCGCCCTACAGCA
    uvrD2GGATCTGGAAGTTCTGCTCAGC
    mexY1AGCAGCCTCGCCCTACAGCA
    mexY1BGGATCTGGAAGTTCTGCTCAGC
    mexZRTA1TTACCTCCTCCAGCGGC
    mexZRTA2GTGAGGCGGGCGTTGTG
    PA5470C1CCAAAGAGGAATCCCAGAAA
    PA5470C2CAGGCAGACCTCGATCTTGT
    PA5471C1TCGAGGTAATCGAGGAGGTG
    PA5471C2AGGGTCTGCAAACGGATCTC
    oprDRTC1CATCTACCGCACAAACGATG
    oprDRTC2ACAGAGTTGGCGAGGAAAATC
    parRSTC1CGAACTGGAGGAAATGGTCT
    parRSTC2ATGCGGATCTGTTCGACCT
    pmrARTC1GATACCGTGGAATGGGTGAC
    pmrARTC2GGCTTGGTCAGGTAGTCGTC
    pmrBRTC1ACGAACTCAACCTCCTGCTG
    pmrBRTC2ATCTGCTCCATCAAGGTGCT
    PA1559RTC1GCAGCAACTGGTGGACTACA
    PA1559RTC2CATGCGGAAGACCAGAAGAT
    PA1797RTC1GGACCCTTTGCAGATGACTC
    PA1797RTC2CGGAGTGTTTCCTGAGAAGC
    PA2358RTC1GTACTGTTCGCCGGAACAAC
    PA2358RTC2CCTGGAGCAGGAATATCTGG
    PA2655RTC1GTGCTGGTGTTCCTGTTGG
    PA2655RTC2CGTAGGTCCCCCAGATCG
    PA3554RTC1GTGGCTCGAATACCATGTGA
    PA3554RTC2TGCCGTATTTCACGCAGTAG
    PA4773RTC1CAGTGGATCGAGGAAAGCAT
    PA4773RTC2GTACTCCGGCCAGGTATGG
    PA4774RTC1CGCCGAACCACTTCTATTTC
    PA4774RTC2TCGTGGTACAGCGACTCATC