Table 1.

Primers used for qPCR

GenePrimer sequence
ForwardReverse
BCAL0421GTTCCACTGCATCGCGACTTGGGCTTCGTCGAATTCATCA
BCAL1110AGCTGCCGTCCGACCTGTTCTACGCGGCCATCGTGCAGAA
BCAL1459ATCCCTTGAAATCGAGCATCATACGCTCGACAACGTGCATTA
BCAL1857GCGGTGCCGATCCTTCCGTTTAACACGATCTCGCCGATCACGAC
BCAL1861GATCACCTGCTTCGTGACGTTGACGTCGTGTTCCGCAAGAT
BCAL2370TGGAACGACGGCGACTGCATCGTGTGCTGGATGCCGGAGA
BCAL2451ATCGCGATGGCGTGGAACATGAAGAACAGCACGATGCCCAGGTC
BCAL2606TCGACGACGACCAAGAACTCGCAGCACGGACACTTCCATCC
BCAL2607GAACCAGCCGATCCTCGACCTGGCCGTGCTGACCATCGTCTTCT
BCAL2820CTGCCATCGGCTGGCGCGAAGCACCGATACGCGCAGGTCT
BCAL2821GGGCCGCTGGCTCATCATCTGCGTCTTCGCGGTCGTTTCC
BCAL2822GCGGTGTTCCCGAACCCGAATGCTCGACCTTGTTGCTGGCGT
BCAL2823ATGCGATGTTCGACCGCGTGTTCCGCGACGTACTCGCACTTCAT
BCAL2846TACCGCCTCCAAGGCCGATCAACGGTCAGGTCGCGTTCGGATTC
BCAM0772ACCGCATCGCGAAGATCCTGACGAATGCGCTTCGGCCAGTG
BCAM0773TGGGCGAACGACAGCACGAAGCGACGCGTGGTAGCCCTT
BCAM0924ACATCGCACGGCACACTCCAGCGAGTACGTCCCAGCCGTT
BCAM0925CGCTTCAGCAGCAACCGGTGAGGCCGACGGAACAGCAGCT
BCAM0926GACCGCGGTATTCCTGCCGAACGGCCATCGACAGCGTGAA
BCAM0928TTGCGCCGGAGACGAAAGTGACGCGCCAGTAACCTCGCGAACAT
BCAM0991GCCAACGTCTACCGGATGAAGACCGTGCCGATGATGTAGAA
BCAM2073CGCCGACTTCGACAAGGCCTACCCTGGCGTGCGACTTCCTTCAG
BCAM2537CCAGATCGCGCTCGTGACGTTCGCAACCCGAACACGCTGTCGAA
BCAS0081ATGGGGCACGTGGTCGACTGGCGCAACCGCATCGGAAAGT
BCAS0083CGGCTTCCATGCGACGTCCACGGCTTCAGGCTCCCGTCGATC
BCAS0175ATGGCCAGTTCGCTCATCAACGCGATGTCGATACTCGAAT
BCAS0637ATGCGCGGCATCCTGAAGGTCGAGCTGCTTGCCGGTTTCC
BCAS0638CGGCGAGGAACTGCTCGTGATTTCCTGGCGGCCGGTGATT
IG_2538832GCCGGCCGACGCGTTACAATAGGCGCGGTGCGCAGGTAT