Table 2.

Oligonucleotide primers used in this study

OligonucleotideSequence (5′–3′)a
467UAAATATTTATAATGCAGTTAACG
467LGACCAGAAGTATAAACCATACCA
2955UACACATTAGCTGTTAACATGACG
2955LATGTTTCACTTCTAGCAACATGG
467attB1F1GGGGACAAGTTTGTACAAAAAAGCAGGCTAACTGCACTATGTACTGGAAGAGGA
467attB2R1GGGGACCACTTTGTACAAGAAAGCTGGGTGAAGCTTGATTAAACATATTAATCG
2955attB1F1GGGGACAAGTTTGTACAAAAAAGCAGGCTTTAGATGAAGCAAAAGTCGTGTATC
2955attB2R3GGGGACCACTTTGTACAAGAAAGCTGGGTATAAATTCATTTGATTAAGTGCTGT
467_F1AAGAGTATTGGCATTTGAAATTGAT
467_R1CCTTCTCAGCCTGACTAAGCAT
467SbGATCCAAGACGTCGCGGTGAA
467ScGAGTGTTGGGCATTATGTTCAATAC
467SdCGAGTTTGGAAGAATTGGCTCTACT
467SeAACAGGCGAAGTCTTCAATAAGTGA
467SfACGTAGAACCTGGCAACAGTTTATC
2955_F1TTCCATTTCAGACATAACGCCTGT
2955_R1TGCATTAACCGAACCCTGTATATCA
2955SbCACCGATGGCACCATTATATGTC
2955ScGAAAGTTCAAATCAAGAGCCGTCA
2955SdAAATGTTGGGAATCAGAAAACTTCA
2955SeCATTATGAACCTTGTCATCACGAAG
2955SfCAAAGGGTACATCAGTTGGCAGTAC
mprFF1AAGAAGCACTCATAATCGGCTGTT
mprFR1GGCGACTTAACTTTAGCTCATTTCA
mprFS1TGTAGGTTTCGGTGGCTTTATTG
mprFS2CATCAGCTAAGAAGTACATTGAGGG
mprFS3GTATTGCGCTATTACTTCTGGCTTA
mprFS4TAACGCAATTTTCAACTTCAGGTAA
  • a Engineered attB sites for recombination of PCR amplicons into the pKOR1 vector are underlined.