Table 2.

Primers used for qPCR on LightCycler

PrimerSequence (5′–3′)Reference
gyrB FGGTGGCGACTTTGATCTAGC37
gyrB RTTATACAACGGTGGCTGTGC37
pbp1 FAGGTAGCGGTTTTGTGTCCThis work
pbp1 RTATCCTTGTCAGTTTTACTGTCThis work
pbp1phiGATTATCTATCTGTTTAGGATCCThis work
pbp2 FTATTTAGCCGGTTTACCTCAThis work
pbp2 RTTTTGACGTTCTTCAGGAGTThis work
pbp3 FGTGGACCAACCTCATCTTTAThis work
pbp3 RCGGGAGACCCTTATTATTCTThis work
pbp4 FTGGTGCTAACTGCTTTGTAAThis work
pbp4 RGCTAAAGCTATCGGAATGAAThis work
lukS-PV FAATAACGTATGGCAGAAATATGGATGTThis work
lukS-PV RCAAATGCGTTGTGTATTCTAGATCCTThis work
ISPVL1CTAATTGTTCTTTAACTTGAATTAAGTTTGACCThis work
ISPVL2TGTTAAGAACATGAAGCCTTTGATTGTThis work
RNA III FGGGATGGCTTAATAACTCATACThis work
RNA III RGGAAGGAGTGATTTCAATGGThis work
sarA FTGTTTGCTTCAGTGATTCGTThis work
sarA RCAGCGAAAACAAAGAGAAAGThis work
saeR FCGTGGATGATGAACAAGACAThis work
saeR RTTCACGGTATTAGCATCTTCGThis work
rot FGGGATTGTTGGGATGTTTGTTAThis work
rot RCATTGCTGTTGCTCTACTTGCThis work