Table 1.

Novel PCR primers used in the study

Gene or region amplifiedPrimer pairNucleotide sequence (5′–3′)Nucleotide coordinates
mecAmecA_fwACCTTCTACACCTCCATATCAC24320–24341a
mecA_rvCGTTACGGATTGCTTCACTG26452–26433a
pbp1Pbp1_fwCGATAATGTAAAGGTAGTGCGTAG828245–828222b
Pbp1_rvCCCTTATTTAATGTAGCCATTCTTG825960–825984b
pbp2Pbp2_fwGATGAAAGTGAGGACCGCG477649–477631b
Pbp2_rvATAACTGAGGATTTTATGTTGAGTGG475419–475444b
pbp3Pbp3_fwGAAAGACTTTGAATAGAGGTAGGTAG332226–332251b
Pbp3_rvTGCGCTACACAATCGTCAG334356–334338b
pbp4Pbp4_fwTTGGAAAAGGGAAGATTAACGC308863–308884c
Pbp4_rvGCAACTTGTCCGTTTTTAGTATG310208–310186c
ccrA1B3M10/0061ccrB3M10/0061 F1CTACTTGAAGTTATCCAATC10125–10144d
ccrA1M10/0061 R1CACATTACTCGCTGATTTAG13427–13408d
mecAM10/0061mecAM10/0061 F1CCAGATATAGTAGCATTATA1799–1818d
mecAM10/0061 R1AAAGATGACGATATTGAG3672–3655d
orfX-mecIM10/0061orfX F1GTGTTAATTGAGCAAGTGTA418–437d
mecIM10/0061 R2GCATTCTTACATCCGTTTTG6070–6051d
mecIM10/0061-ccrA1M10/0061mecIM10/0061 F1CTATGATATATCAGCGTCAG56041–56023d
ccrA1M10/0061 R1ACAAGCTCAAGCGATACGGT12563–12544d
ccrA1M10/0061-ORF_119M10/0061ccrA1M10/0061 F1AATAACGTAATGTGCGGTGC12421–12440d
ORF_119M10/0061 R1ACTTAAATCAGGCTTATATCC20622–20602d
ORF_119M10/0061-arsCM10/0061ORF_119M10/0061 F1TCTAGTATCTGAAAGGTC20475–20492d
arsCM10/0061 R1AACCATACGTCAGACTTGA27963–27945d
arsCM10/0061-downstream of DR3arsCM10/0061 F1GACCACTCTTTACCTGCT27809–27826d
tnp1S2 R1AGATCATGGAAAACCGATCA34397–34378d
  • a Nucleotide coordinates based on the nucleotide sequence of SCCmec III (GenBank accession number AB037671.1).

  • b Nucleotide coordinates based on the nucleotide sequence of S. aureus strain MN8 contig 215 (GenBank accession number ACJA02000004.1).

  • c Nucleotide coordinates based on the nucleotide sequence of S. aureus strain MN8 contig 215 (GenBank accession number ACJA02000003.1).

  • d Nucleotide coordinates based on the nucleotide sequence of SCCmec XI of M10/0061 (GenBank accession number FR823292).