Table 1

Oligonucleotides used in this study

Primer use and primeraSequence (5′ → 3′)Source or reference
blaCMY-16 environment analysis
    CMY2-F1CGGAACTGATTTCATGATGThis study
    CMY2-R5TTATTGCAGCTTTTCAAGAAThis study
    Down_SugEACCTGCAAACGCTTCTTTCThis study
    TraA-downFGTTGTGCAACTCAGCAATGGCThis study
    ISEcp1CCTAGATTCTACGTCAGTACTTThis study
    InvISEcp1TTCAATAAAATCAAAAATCCCAThis study
    CMY-16downFTGTTGTCATCTACACTTAACThis study
    TraCupRATCAACGTTTCTTCGAGTTTCThis study
qnrA6 and aac(6′)-Ib′environment analysis:
    5′CSGGCATCCAAGCAGCAAG27
    qnrA6FCAGCAAGAGGATTTCTCACGThis study
    qnrA6RCTAATCCGGCAGCACTATGACThis study
    TniBRATGGACCTCGATGCCCGAACGGThis study
    C6T3RGCTATCAGTTGAACGAGCThis study
    DownqnrF1AAGCACTTGGCGCTGTCTTThis study
    GmF1GCATTCGCCAGTGACTGGThis study
    GmR1TACAGCATCGTGACCAACAGThis study
    APH(3′)-IFATGAGCCATATTCAACGGGThis study
    APH(3′)-IRAGAAAAACTCATCGAGCATCThis study
Other antibiotic resistance gene analysis
    APH(3′)-VI-FCTGCTGCACGTATTTCTCGThis study
    APH(3′)-VI-RCGGAAACAGCGTTTTAGAGCThis study
    FloFTGATCCAACTCACGTTGAGCThis study
    FloRGAACGCAGAAGTAGAACGCGThis study
    TetDF-FWGGAATATCTCCCGGAAGCGG1
    TetDF-RVCACATTGGACAGTGCCAGCAG1
    StrABFGACAAGAGTACGCCGCAGCTCThis study
    StrABRATGATGCAGATCGCCATGTAGThis study
    sul2-FGCGCTCAAGGCAGATGGCATT4
    sul2-BGCGTTTGATACCGGCACCCGT4
  • a Only the primers which gave a positive PCR amplification are given. Oligonucleotides used for sequencing are not indicated.