Table 2

List of primers used in experiments

PrimerSequence (5′–3′)a
Cloning
    02968FBCGGGATCCCACTATCGCGGCGATTGTA
    02968RSAAAAGTACTTCATGCGGATCGCTGACG
    02968HRCCCAAGCTTTCATGCGGATCGCTGACG
    02968BFCGGGATCCTTGCACTTTATGTGCGGT
    OqxRbamHIFCGGGATCCTTTACTTCGCAGGCTAAC
    OqxRsca1RAGTACTTCATTTTCTGGTGACGAAAA
Deletion
    Ci-02968CCGTTCCAAGCGGCCGCAAGAGCGCATCTCGTCAGCGATCCGCATG
    Co-02968AAAAAGTCGACTCAGTCCTGACCCGGCCCATG
    Ni-02968CGCTCTTGCGGCCGCTTGGAACGGTCGCGGCCG GTTAAAAGCATC
    No-02968AAAAACTGCAGGTATGGACTAATTTATCGGTGC
    02968delchkFTCAGCCAGATGGCAACCG
    02968delchkRACCGCTTCAATGCGACCG
    Ci-acrBCGCTCTTGCGGCCGCTTGGAACGGGGCGCGCCTCTCCTGGTT
    Co-acrBAAAAACTCGAGCCACTTTTGCAAATCCGTAGAG
    Ni-acrACGCTCTTGCGGCCGCTTGGAACGGGTGTCCAATTTCAAAATGTTC
    No-acrAAAAAACTGCAGGCGTAGCGTCGGG CAGAATTG
    AcrABdelchkFGAGCGAATGTGGCAATGTGC
    AcrABdelchkRCACGGTCATTTCACCGACG
Sequencing
    02968FBCGGGATCCCACTATCGCGGCGATTGTA
    02968RSAAAAGTACTTCATGCGGATCGCTGACG
    02698intFGACAGATCCTGAATGAT
    02698intRTGAATGTTTCCCCAGGTT
    OqxRFGTCACCAGAAAATGATTAATGCGC
    OqxRRGCCTTTGCCCGTGAAATCAG
Q-RTPCR
    Kp02968FTGGATCGACAACCATCTTGA
    Kp02968RAAGGACTGCTGGGAGTCAAA
    Kp_16SQ_FGTTACCCGCAGAAGAAGCAC
    Kp_16SQ_RCTACGCATTTCACCGCTACA
    02969FAAGGTGCTGGTGAAGTCGAT
    02969RGGAGACGAGGTTGGTATGGA
    Kp_ramAQ_FAGCCTGGGGCGCTATATT
    Kp_ramAQ_RGTGGTTCTCTTTGCGGTAGG
    Kp_marAFTCGAGGATAACCTGGAATCG
    Kp_marARACAAATGGGCTCATTGCTC
    oqxRqpcrFTAACGAAGCCTGCTCTGCTT
    oqxRqpcrRAATGGTTCCGCTAACTCGTG
5′ RACE
    GSP1ATGTCTGCGCAACAG
    GSP2GCTCGTCGGGCAACGGTGTC
    GSP3CCAGACGGCTATCAAGATGGTTG
  • a Underlined sequences denote restriction enzyme cut sites.