Table 1

Primers used in this work

PrimerPrimer sequence (5′—3′)PCR product size (bp)UseReference or source
ACrnaFGGGCTGGCCTCGAAAGAGGAC246Quantification of ampC mRNA15
ACrnaRGCACCGAGTCGGGGAACTGCA
MexB-UCAAGGGCGTCGGTGACTTCCAG273Quantification of mexB mRNA29
MexB-LACCTGGGAACCGTCGGGATTGA
MexD-UGGAGTTCGGCCAGGTAGTGCTG236Quantification of mexD mRNA29
MexD-LACTGCATGTCCTCGGGGAAGAA
MexF-UCGCCTGGTCACCGAGGAAGAGT254Quantification of mexF mRNA29
MexF-LTAGTCCATGGCTTGCGGGAAGC
MexY-FaTGGAAGTGCAGAACCGCCTG270Quantification of mexY mRNA29
MexY-RaAGGTCAGCTTGGCCGGGTC
ponArnaFGAAGCCGTGACCTGGGACAGC231Quantification of ponA mRNAThis work
ponArnaRGGAGAAGCCGCCGACCAGCG
mrcBrnaFCAACCTGGTGCTCGACGTGCTC217Quantification of mrcB mRNAThis work
mrcBrnaRCGGATCGAAGCTGGTGAAGATGC
dacBrnaFGGCCCGACCTACCAGTGGAAG217Quantification of dacB mRNAThis work
dacBrnaRAACGGCTTGGTGTCGTCGCCG
PBP2rnaFGTGACTCCATCGACCGGCCGC227Quantification of PBP2 mRNAThis work
PBP2rnaRGTAGATCGCCGACTCCAGGCTC
PBP3rnaFCGGCAGCTTGGTGATCATGGAC223Quantification of PBP3 mRNAThis work
PBP3rnaRCGGGTAGACGTCGACGATATCG
dacCrnaFCGCCTTCGCCGACATGATGAAC218Quantification of dacC mRNAThis work
dacCrnaRAGCAGGTTGCGGTTCGGCTGC
PA-DEFGTACGCCTGCTGGACGATG910ampD amplification and sequencing17
PA-DERGAGGGCAGATCCTCGACCAG
dacBFCGACCATTCGGCGATATGAC1,400dacB amplification and sequencing24
dacBRCGCGTAATCCGAAGATCCATC
oprD-FCGCCGACAAGAAGAACTAG1,413oprD amplification and sequencing16
oprD-RGTCGATTACAGGATCGACAG
ponAFCGAAGGCCAGGCAAATGGC2,636ponA amplification and sequencingThis work
ponARCTCCCGTCGTCGCCAACG
ponAF2CCTGCAGGACGCGGATCGponA sequencingThis work
ponAR2CTCAAGCACCTGGGCCAGC
ponAR3CGCTCGAGGATCCAGTTGC
mrcBFCATTATGGCGGGAAGGGGTG2,551mrcB amplification and sequencingThis work
mrcBRGCGACACACCATGGTGGTTC
mcrB-F2GAACCACCATGGTGTGTCGCmrcB sequencingThis work
mrcB-R2CGAGGCCGAGCTTGGCGG
PBP2FGAGCAGCGCTGGTCGCTG2,135PBP2 amplification and sequencingThis work
PBP2RGCAGGCGCTGCAACAGGC
PBP3FGGCCGGTTGATTCTCGAGC1,921PBP3 amplification and sequencingThis work
PBP3RGGTCAGCTCGCGGATCAGC