Table 1

Nucleotide primers used in this study

PrimerFunctionSequence (5′–3′)a
14/157_F1PCR mapping of blaFIM-1-carrying DNA fragment with genomic DNA of P. aeruginosa FI-14/157ACTTCCACATGCTGTGGCTC
14/157_R1PCR mapping of blaFIM-1-carrying DNA fragment with genomic DNA of P. aeruginosa FI-14/157CTCCGGGTACAACAACTGC
FIM-1_FPCR mapping of blaFIM-1-carrying DNA fragment with genomic DNA of P. aeruginosa FI-14/157GAAGCACATGGAAAACTGGG
FIM-1_RPCR mapping of blaFIM-1-carrying DNA fragment with genomic DNA of P. aeruginosa FI-14/157GATGGGCGAATGAGACAGC
FIM-1exp_FAmplification of the blaFIM-1 ORF for cloning in pET9a to obtain pET-FIM-1GGAATTCCATATGCGCCCCTTACCCCATTC
FIM-1exp_RAmplification of the blaFIM-1 ORF for cloning in pET9a to obtain pET-FIM-1CGGGATCCTCAGGGTGTGGACGGTATG
  • a The restriction sites used for cloning amplification products are underlined.