Table 1

Primers used in this study

Primer namePrimer sequenceSource or reference
Mup-FTAATGGGAAATGTCTCGAGTAGA34
Mup RAATAAAATCAGCTGGAAAGTGTTC
qacA/B-FCTATGGCAATAGGAGATATGGTGT31
qacA/B-RCCACTACAGATTCTTCAGCTACATG
qacA/B-RT-FAGTGAAGCCATACCAGCTCCAACTThis study
qacA/B-RT-RTTGCACCAATTGCACCCGGATTAG
Mup1CCCATGGCTTACCAGTTGA38
Mup2CCATGCAGCACTATCCGAA
MupA-1fACTTTACTTTATCCAATATATCTTTC38
MupA-1rAATGTAGATAATATATTCCATACAC
MupA-2fTACTGGGTTGACATGGACTCCC38
MupA-2rTCTTTGTTATAACATTTAAGAAATCC
MupA-3fTGGTATTGTTCATATAGCACCA38
MupA-3rAACCAAACATCGATTACTTCTTC
MupA-4fATATTGAGTTGCATAGACCTTATG38
MupA-4rATCGTAATTATTTACATAAATATTAC
MupA-5fAATACATTAGATAATTGGGCTCTT38
MupA-5rTTTAAGCTCATAGGTAATATAGTG
MupA-6fGGTGATTAAACCTAATAGTCAATTAAAC38
MupA-6rTTTATTTGGTAATTTAGAATAATC