Table 1

PCR primers used in this study

Primer targetPrimer nameaSequence (5′–3′)Expected product size (bp)Reference
Class 1 integrase201FCCTCCCGCACGATGATC2801
202RTCCACGCATCGTCAGGC
Class 1 gene cassette, variable region5′ CSGGCATCCAAGCAGCAAGVariable25
3′ CSAAGCAGACTTGACCTGA
fimH SNPfimH FTCGAGAACGGATAAGCCGTGG50649
fimH RGCAGTCACCTGCCCTCCGGTA
16S ribosomal DNA, positive control16S8FAGAGTTTGATCCTGGCTCAG8001
16S8RGGACTACCAGGGTATCTAATCC
ESBL multiplex
    TEM variants, including TEM-1 and -2MultiTSO-T_forCATTTCCGTGTCGCCCTTATTC8007
MultiTSO-T_revCGTTCATCCATAGTTGCCTGAC
    SHV variants, including SHV-1MultiTSO-S_forAGCCGCTTGAGCAAATTAAAC7137
MultiTSO-S_revATCCCGCAGATAAATCACCAC
    OXA-1, -4, and -30MultiTSO-O_forGGCACCAGATTCAACTTTCAAG5647
MultiTSO-O_revGACCCCAAGTTTCCTGTAAGTG
CTX-M universalCTX-M Univ FTTTGCGATGTGCAGTACCAGTAA50045
CTX-M Univ RCTCCGCTGCCGGTTTTATC
CTX-M familiesCTX-M-1-all FATGGTTAAAAAATCACTGCG87645
CTX-M-1-all RTTACAAACCGTCGGTGACGAT
CTX-M-9-FGCAGATAATACGCAGGTG39245
CTX-M-9-RCGGCGTGGTGGTGTCTCT
CTX-M multiplex
    Variants including CTX-M-1, -3, and -15MultiCTXMGp1_forTTAGGAARTGTGCCGCTGYA6887
MultiCTXMGp1_revCGATATCGTTGGTGGTRCCAT
    Variants including CTX-M-2MultiCTXMGp2_forCGTTAACGGCACGATGAC4047
MultiCTXMGp2_revCGATATCGTTGGTGGTRCCAT
    Variants including CTX-M-9 and -14MultiCTXMGp9_forTCAAGCCTGCCGATCTGGT5617
MultiCTXMGp9_revTGATTCTCGCCGCTGAAG
    Variants including CTX-M-8, -25, -26, -39, and -41MultiCTXMGp8_forAACRCRCAGACGCTCTAC3267
MultiCTXMGp8_revTCGAGCCGGAASGTGTYAT
pabBpabB FTCCAGCAGGTGCTGGATCGT3473
pabB RGCGAAATTTTTCGCCGTACTGT
  • a F, forward primer; R, reverse primer.