Table 1

Primers used for PCR amplification and real-time RT-PCR

PrimerSequence (5′–3′)Reference
23S rRNA gene amplification
    FICCCTAAGTCAAGCCTTTCAATCC20
    FIICGTTATAGATACGCTTAGCGGTTATG20
    FIIICATCGAGCAAGAGTTTATGCAAGC20
    CJ-copy-RCTACCCACCAGACATTGTCCCAC20
Fragment of 23S rRNA gene
    23S-domV-FGTAAACGGCGGCCGTAACTAThis study
    23S-domV-RGACCGAACTGTCTCACGACGThis study
    23S-2611FATGTCGGCTCATCGCATCCTGG20
    23S-2611RCATCCATTACACACCCAGCCTATC20
Ribosomal protein L4
    L4-FGTAGTTAAAGGTGCAGTACCAThis study
    L4-RGCGAAGTTTGAATAACTACGThis study
Ribosomal protein L22
    L22-FGAATTTGCTCCAACACGCThis study
    L22-RACCATCTTGATTCCCAGTTTCThis study
CmeR and cmeABC promoter
    cmeR-FTAGAAAAGTATATTTGTATACCCT16
    cmeR-RCGCCACTAACTTGAGGCTTTA16
Real-time RT-PCRa
    16S-FTACCTGGGCTTGATATCCTA21
    16S-RGGACTTAACCCAACATCTCA21
    CmeB-FACGATTCAACCTTTTCCCAGCThis study
    CmeB-RTTTGCTACTTGAGCAATCGCTTCThis study
    Cj1687-FTGGTGGTTTGGACTCTTTCTGGGAThis study
    Cj1687-FTCTCTGCGATTAAAGCCACCACGAThis study
    Cj1375-FGCTTTACCACGATTTTCTTCTGTGAThis study
    Cj1375-RTACACCATGCTTTTAGGAAGAATGCThis study
    Cj1257c-FATCGCCGTGATAGCGCCTAAAGAAThis study
    Cj1257c-RGCCACCAAACAAAGGCCCAAGTAAThis study
  • a Sequences and gene names are based on C. jejuni NCTC 11168.