Table 3

Oligonucleotide primers used in this study

Primer nameSequence (5′→3′)TargetReference
mecC1 + 2_F5′-AAGTTAATCAAAAATGGGTTCAGC-3′mecCThis work
mecC1 + 2_R5′GGTTGTAATGCTGTACCAGATCC-3′mecCThis work
blaZ_XI_F5′-CGTTTTGCWTATGCTTCCAC-3′blaZThis work
blaZ_XI_R5′-CKGGTTCTTTTCTAGATGGATG-3′blaZThis work
MecA1GTA GAA ATG ACT GAA CGT CCG ATA AmecA30
MecA2CCA ATT CCA CAT TGT TTC GGT CTA AmecA30
16SFCCTATAAGACTGGGATAACTTCGGG16S rDNA31
16SRCTTTGAGTTTCAACCTTGCGGTCG16S rDNA31