Table 1

Oligonucleotide primer pairs used

Procedure and gene/ampliconPrimer designationSequence (5′–3′)Reference or sourceProduct size (bp)
Detection of TET resistance genes
    tet(M)TETM3ATGGAAGCCCAGAAAGGAT11740
TETM2GAACTCGAACAAGAGGAAAGC11
    tet(O)TETO1AACTTAGGCATTCTGGCTCAC11519
TETO2TCCCACTGTTCCATATCGTCA11
PCR evidence of Tn916
    int916int-forGCGTGATTGTATCTCACT121,046
int-revGACGCTCCTGTTGCTTCT12
    xis916xis-forAAGCAGACTGAGATTCCTA13194
xis-revGCGTCCAATGTATCTATAA13
    orf7-orf8aO15GTACGTCCACCAATGTGG14902
O16GCACGCTTCCACGAAAGGAG14
    orf20-IR18–19aJ12CCCATTGAAGACGCAGAAGT15801
J11AAAAATCCCTACCGCACT15
    orf24-orf20aTN6-revCCATCAAACATTCATTCAGC153,358
J13GGTTTTGTGGTTAGTTTT15
PCR mapping of Tn5801.Sagb
    int58011812GTCCATACGTTCCTAAAGTCGTC8726
1811CCGATATTGAGCCTATTGATGTG8
    sav400400RTCGTATTTCAAGGCTTCGTCThis study369
400FTACCGAAGAGTCCATCAAACThis study
    sav408408RAATGTAGGGGCGACTTGATGThis study1,005
408FACTGGCTTATGGCGTTTCTCThis study
    sav409409RGCAGACAAACCAAGATAAGCThis study940
409FGAGAGCGAATCAAAGCCAACThis study
    sav413413RAACACCGTTGTCGTCTCCACThis study743
413FTTGCTAGTAATATAAGGGCGAThis study
    sav414414RATTAGATACACAACATCCTCATCThis study579
414FACAGGCAATCCCATCAGAACThis study
    sav415415RTAGATGAGGCTTGATACACCThis study677
415FTTCTCGTAACGGCTCCTATGThis study
    int5801-tet(M)1812GTCCATACGTTCCTAAAGTCGTC84,971
TETM2GAACTCGAACAAGAGGAAAGC11
    tet(M)-sav400TETM3ATGGAAGCCCAGAAAGGAT113,362
400FTACCGAAGAGTCCATCAAACThis study
    sav400-sav408400RTCGTATTTCAAGGCTTCGTCThis study9,331
408FACTGGCTTATGGCGTTTCTCThis study
    sav408-sav409408RAATGTAGGGGCGACTTGATGThis study2,612
409FGAGAGCGAATCAAAGCCAACThis study
    sav409-sav411409RGCAGACAAACCAAGATAAGCThis study2,142
411FGAGATTAGCAGAAGGTATTGTGThis study
    sav409-sav413409RGCAGACAAACCAAGATAAGCThis study3,874
413FTTGCTAGTAATATAAGGGCGAThis study
    sav413-sav414413RAACACCGTTGTCGTCTCCACThis study1,968
414FACAGGCAATCCCATCAGAACThis study
    sav414-sav415414RATTAGATACACAACATCCTCATCThis study3,295
415FTTCTCGTAACGGCTCCTATGThis study
Tn5801.Sag chromosomal integration sitec
    SAG967 (guaA)LJ967CGTGAAGAAATCGCTAAAGThis study1,228
    int58011811CCGATATTGAGCCTATTGATGTG8
    sav411CF1TTCAAAGGAACAGAAGCGGGThis study1,414
    SAG964RJ964GAAGTAGAAGAGAGCCATAGThis study
Search for circular form
    int58011811CCGATATTGAGCCTATTGATGTG8
    sav411CF1TTCAAAGGAACAGAAGCGGGThis study
  • a ORFs numbered according to the reported organization of Tn916 (GenBank accession no. U09422).

  • b Tn5801 from the genome of S. aureus Mu50 (DDBJ accession no. BA000017; sav genes) was used as the reference sequence. In PCR assays, S. aureus Mu50 (ATCC 700699) was used as a positive control and S. pneumoniae BM4200 (Pasteur Institute Collection), harboring the Tn916-like transposon Tn1545 (1), was used as a negative control.

  • c The genome of S. agalactiae strain 2603V/R (GenBank accession no. AE009948; SAG genes) was used as the reference sequence.