Table 1

Primers used in this study

PrimerPrimer sequence (5′–3′)Source or reference
ΔkpnEF-FGCCCTGTCATATATTTTTCTTGCCTTTGCGThis study
ΔkpnEF-RGCCGCCAGGGACAGGATGCCGTAGATCTTGThis study
kpnE-FGCATCATATGTTTTATTGGATTTTATTAGCTTTAThis study
kpnE-RTTCAGGATCCTCAAACTGCTGCATGGGCCACCTCCThis study
kpnF-FGATACATATGCAGCAGTTTGAGTGGATCCACGCCGThis study
kpnF-RTTCAGAATTCTCAGGCGAGTTTAATTAACACCATGThis study
FL kpnEF-FTACTGAATTCTCCCGACCTCAAACTTCCTTGCCTAThis study
FL kpnEF-RTTCAGAATTCTCAGGCGAGTTTAATTAACACCATGThis study
promkpnEF-FTTAGCCATAGGATCCCGACCTCAAACTTCCThis study
promkpnEF-RCCATTTCATAGACAAGGTGCCGGTAATTTCAGCThis study
RTkpnE-FATTGCTGAAATTACCGGCACThis study
RTkpnE-RAAATACCGATCCCTTCCCACThis study
RTrpoBNTGCGGTTGGTCGTATGAAGTTThis study
RTrpoBCTTGGCGTTGATCATATCCTGAThis study
Kprt3706-FTCAGTCATTACGGCAGAAGA47
Kprt3706-RAGATATAAGGGCATCAACAGATT47
Kprt3709-FCGATGCGTGAGTTTCTACA47
Kprt3709-RTGATATGGTTTCGGCTAATTCC47
Kprt3712-FAGTCATCTTCAGCATATTTCTCT47
Kprt3712-RCAACAATAGCACCTTTCCCT47
MagAF1GGTGCTCTTTACATCATTGC48
MagAR1GCAATGGCCATTTGCGTTAG48
K2wzy-F1GACCCGATATTCATACTTGACAGAG48
K2wzy-R1CCTGAAGTAAAATCGTAAATAGATGGC48
K5wzxF360TGGTAGTGATGCTCGCGA48
K5wzxR639CCTGAACCCACCCCAATC48
wzxK54FCATTAGCTCAGTGGTTGGCT48
wzxK54RGCTTGACAAACACCATAGCAG48
wzyK57FCTCAGGGCTAGAAGTGTCAT48
wzyK57RCACTAACCCAGAAAGTCGAG48
wzyK20FCGGTGCTACAGTGCATCATT48
wzyK20RGTTATACGATGCTCAGTCGC48
rmpAFACTGGGCTACCTCTGCTTCA48
rmpARCTTGCATGAGCCATCTTTCA48