TABLE 2

Nucleotide primers

Purpose or target and primer nameNucleotide sequencea (5′ → 3′)
Gene sequencing
    mexZ and mexX-mexZ intergenic region
        SeqZ1GCAGCCCAGCAGGAATAG
        SeqZ2GCCTGTCGGTGCTCTACATC
    parRS
        SeqparSC1GCCAGGCAGGGGAAATACT
        SeqparSC2CATACCAGCAGGGCGGATG
        SeqparSC3AAGAACCTGCTGGTGGTACG
        SeqparSC4ATGCGGATCTGTTCGACCT
        SeqparSC5CGAACTGGAGGAAATGGTCT
        SeqparSC6GAAAGATGCATTGCACGAAA
        SeqparRC1GCATATAATGCCAGCCGATT
        SeqparRC2GGTCGACCACGAAGATCG
    PA5471.1
        SeqPA5471.1S1GGAGTCCTTCATGACCTTCG
        SeqPA5471.1S2GTGGTTTGCAGTTGCTGGAT
Cloning of genes parRS for cis complementation
    CloparRSC1GAGGGAAAAGCAGAAGTCACC
    CloparRSC2CGAGGTGTCCCATGCTAGG
    CloparRSBamHIS1CTCGGATCCGAGGGAAAAGCAGAAGTCACC
    CloparRSHindIIIS2CTCAAGCTTCGAGGTGTCCCATGCTAGG
Gene expression measurement by RT-qPCR
    RTrpsL1GCAACTATCAACCAGCTGGTG
    RTrpsL2GCTGTGCTCTTGCAGGTTGTG
    RTmexY1ATTACCTCCTCCAGCGGC
    RTmexY1BGTGAGGCGGGCGTTGTG
    RTPA5471C1GAAGGCAAGGCGATCCAG
    RTPA5471C2AGGCGCTTTTCCAGTTTGT
    RTPA1797C1GGACCCTTTGCAGATGACTC
    RTPA1797C2CGGAGTGTTTCCTGAGAAGC
    RTarnAC1GTGGCTCGAATACCATGTGA
    RTarnAC2TGCCGTATTTCACGCAGTAG
  • a The recognition sequences of endonucleases BamHI and HindIII are underlined.