TABLE 2

Oligodeoxynucleotides

PCR targetPrimerSequence (5′→3′)Positionsa
OXA-279/OXA-290OXA-pa-FATGCCAAAAATACTAAAACA1–20
OXA-pa-RTTATTGCGTCTCTAACAATT840–821
OXA-273/OXA-270OXA-pi-FATGACTAAAAAAGCTCTTTT1–20
OXA-pi-RCTATAAAATACCGAGTTGT822–804
OXA-304OXA-b1-3-FATGTATAAAAAAGTCCTTG1–19
OXA-b1-3-RCTATAAAATACCGAGTTGT822–804
OXA-266OXA-vene-FATGCTAAAAAAGTTCAAAG1–19
OXA-vene-RCTAATGCTGAATTAAACCT834–816
OXA-301OXA-bere-FATGAAGTTTAAAATGAAAGG1–20
OXA-bere-RTAATCTTAAATAAAAAAATA831–812
  • a Coordinates refer to the first base of the gene.